FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632916_at:

>probe:Drosophila_2:1632916_at:416:29; Interrogation_Position=1059; Antisense; ATACTCGCACTGTGTGCAGAGCCGT
>probe:Drosophila_2:1632916_at:123:87; Interrogation_Position=1076; Antisense; AGAGCCGTCTTATATGCCGGGTCAC
>probe:Drosophila_2:1632916_at:726:57; Interrogation_Position=1132; Antisense; ATGATGCTGCCCAACGGACAGATCT
>probe:Drosophila_2:1632916_at:718:95; Interrogation_Position=1151; Antisense; AGATCTTTGGTCAGATGGCTCTGCC
>probe:Drosophila_2:1632916_at:193:505; Interrogation_Position=1208; Antisense; GTCCGGTGACCAATACGAAGTTCTC
>probe:Drosophila_2:1632916_at:63:601; Interrogation_Position=1262; Antisense; TGTAAGCGGCACTGGATTCGACGCC
>probe:Drosophila_2:1632916_at:102:455; Interrogation_Position=1382; Antisense; GATAAGCTAGAGAACCCGCGAACAC
>probe:Drosophila_2:1632916_at:596:385; Interrogation_Position=1401; Antisense; GAACACCCTCGATTTGAATTCCGAT
>probe:Drosophila_2:1632916_at:602:11; Interrogation_Position=1433; Antisense; ATTCGGCAACTGAATGCTGCTGCTG
>probe:Drosophila_2:1632916_at:97:299; Interrogation_Position=1461; Antisense; CGCGTGCGCAGGTCTATTGATTATT
>probe:Drosophila_2:1632916_at:545:259; Interrogation_Position=1503; Antisense; CACGGGCTGGTTTGTTTCGCAGTCA
>probe:Drosophila_2:1632916_at:721:633; Interrogation_Position=1519; Antisense; TCGCAGTCAGTGCTTCGAGGTTGAT
>probe:Drosophila_2:1632916_at:128:295; Interrogation_Position=1534; Antisense; CGAGGTTGATTCACGCATACGGCGT
>probe:Drosophila_2:1632916_at:363:373; Interrogation_Position=1576; Antisense; GAAGTGGCACACTATGCACAACTAA

Paste this into a BLAST search page for me
ATACTCGCACTGTGTGCAGAGCCGTAGAGCCGTCTTATATGCCGGGTCACATGATGCTGCCCAACGGACAGATCTAGATCTTTGGTCAGATGGCTCTGCCGTCCGGTGACCAATACGAAGTTCTCTGTAAGCGGCACTGGATTCGACGCCGATAAGCTAGAGAACCCGCGAACACGAACACCCTCGATTTGAATTCCGATATTCGGCAACTGAATGCTGCTGCTGCGCGTGCGCAGGTCTATTGATTATTCACGGGCTGGTTTGTTTCGCAGTCATCGCAGTCAGTGCTTCGAGGTTGATCGAGGTTGATTCACGCATACGGCGTGAAGTGGCACACTATGCACAACTAA

Full Affymetrix probeset data:

Annotations for 1632916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720