Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632917_at:

>probe:Drosophila_2:1632917_at:417:31; Interrogation_Position=1017; Antisense; ATAAAACGCCTTGGTGCGACTGCTC
>probe:Drosophila_2:1632917_at:334:353; Interrogation_Position=1049; Antisense; GCAGCGGCTGCATCGGCGGTACAAA
>probe:Drosophila_2:1632917_at:307:461; Interrogation_Position=524; Antisense; GATTACATTGCCATGCACGACGTAG
>probe:Drosophila_2:1632917_at:227:105; Interrogation_Position=547; Antisense; AGACTTGCTGCCCTTGAATGACAAT
>probe:Drosophila_2:1632917_at:627:277; Interrogation_Position=575; Antisense; CTCTATGAGTATCCCAGCAGCTTGG
>probe:Drosophila_2:1632917_at:572:377; Interrogation_Position=622; Antisense; GAAGCTACATCCCAAATACCACTAT
>probe:Drosophila_2:1632917_at:628:563; Interrogation_Position=662; Antisense; GGAATATTACTGGTGCGACGCGAGC
>probe:Drosophila_2:1632917_at:68:383; Interrogation_Position=700; Antisense; GAACGGCATGTCGAACCAGTACTGG
>probe:Drosophila_2:1632917_at:496:411; Interrogation_Position=784; Antisense; GACGCGGCCGCAGAACATTAAGACT
>probe:Drosophila_2:1632917_at:287:689; Interrogation_Position=832; Antisense; TATTCACAACCGCTATCATCGTAAG
>probe:Drosophila_2:1632917_at:650:121; Interrogation_Position=855; Antisense; AGCGGGACACCCAGAAGTGCTTCAA
>probe:Drosophila_2:1632917_at:23:291; Interrogation_Position=915; Antisense; CGGGCCTGGACAACGTGAAGTACAA
>probe:Drosophila_2:1632917_at:331:427; Interrogation_Position=956; Antisense; GAGATGCTCATTGACCAGGTGCCGG
>probe:Drosophila_2:1632917_at:225:129; Interrogation_Position=983; Antisense; ACCATCCTCAACATTTTGCTCGATT

Paste this into a BLAST search page for me
ATAAAACGCCTTGGTGCGACTGCTCGCAGCGGCTGCATCGGCGGTACAAAGATTACATTGCCATGCACGACGTAGAGACTTGCTGCCCTTGAATGACAATCTCTATGAGTATCCCAGCAGCTTGGGAAGCTACATCCCAAATACCACTATGGAATATTACTGGTGCGACGCGAGCGAACGGCATGTCGAACCAGTACTGGGACGCGGCCGCAGAACATTAAGACTTATTCACAACCGCTATCATCGTAAGAGCGGGACACCCAGAAGTGCTTCAACGGGCCTGGACAACGTGAAGTACAAGAGATGCTCATTGACCAGGTGCCGGACCATCCTCAACATTTTGCTCGATT

Full Affymetrix probeset data:

Annotations for 1632917_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime