FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632918_at:

>probe:Drosophila_2:1632918_at:253:587; Interrogation_Position=1104; Antisense; TGGAGAAGCACTCGGAAGCCCCAAT
>probe:Drosophila_2:1632918_at:346:729; Interrogation_Position=1131; Antisense; TTGGGCTGCGGATCCTTCAATTGCA
>probe:Drosophila_2:1632918_at:520:247; Interrogation_Position=1149; Antisense; AATTGCACCGCCGAGTTATGCTGAG
>probe:Drosophila_2:1632918_at:603:607; Interrogation_Position=1170; Antisense; TGAGGCTAAACACATCTCCCCGGAT
>probe:Drosophila_2:1632918_at:20:547; Interrogation_Position=1191; Antisense; GGATCCGCACAAGTTCTCGAAATCG
>probe:Drosophila_2:1632918_at:480:3; Interrogation_Position=1273; Antisense; ATTGTGTTTTCACCCTTATACGCAG
>probe:Drosophila_2:1632918_at:7:699; Interrogation_Position=1288; Antisense; TTATACGCAGTCTTTGATTTGTCAA
>probe:Drosophila_2:1632918_at:565:611; Interrogation_Position=1344; Antisense; TGAACCCAAGACTGATGGCGGCTAT
>probe:Drosophila_2:1632918_at:40:111; Interrogation_Position=1390; Antisense; AGCACTTGGCTTTAGAAGGGCTTAA
>probe:Drosophila_2:1632918_at:243:185; Interrogation_Position=1414; Antisense; AAAATGAATGTACCCACTCTGTAAA
>probe:Drosophila_2:1632918_at:548:105; Interrogation_Position=1465; Antisense; AGACATGACAATTACCCTGTGGTTG
>probe:Drosophila_2:1632918_at:147:347; Interrogation_Position=902; Antisense; GCATCATTCAGATCGGCTATCAGGT
>probe:Drosophila_2:1632918_at:495:709; Interrogation_Position=944; Antisense; TTAAAGGTTGTCATGGCGGCCAGTC
>probe:Drosophila_2:1632918_at:117:373; Interrogation_Position=992; Antisense; GAAGTGTCCCGCTAACGAAGCAACT

Paste this into a BLAST search page for me
TGGAGAAGCACTCGGAAGCCCCAATTTGGGCTGCGGATCCTTCAATTGCAAATTGCACCGCCGAGTTATGCTGAGTGAGGCTAAACACATCTCCCCGGATGGATCCGCACAAGTTCTCGAAATCGATTGTGTTTTCACCCTTATACGCAGTTATACGCAGTCTTTGATTTGTCAATGAACCCAAGACTGATGGCGGCTATAGCACTTGGCTTTAGAAGGGCTTAAAAAATGAATGTACCCACTCTGTAAAAGACATGACAATTACCCTGTGGTTGGCATCATTCAGATCGGCTATCAGGTTTAAAGGTTGTCATGGCGGCCAGTCGAAGTGTCCCGCTAACGAAGCAACT

Full Affymetrix probeset data:

Annotations for 1632918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720