FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632919_at:

>probe:Drosophila_2:1632919_at:561:149; Interrogation_Position=1000; Antisense; ACTTCATCTTCTTCGTGCAGGAGTT
>probe:Drosophila_2:1632919_at:60:655; Interrogation_Position=1024; Antisense; TCAATCTGATTGAGCGGCGCGAACT
>probe:Drosophila_2:1632919_at:539:365; Interrogation_Position=1107; Antisense; GAATCACTGCATGGAGCCGCGAATT
>probe:Drosophila_2:1632919_at:696:363; Interrogation_Position=1127; Antisense; GAATTTTCGCGATTCCGGCGGCGGT
>probe:Drosophila_2:1632919_at:588:283; Interrogation_Position=1161; Antisense; CTGCGCTTGCAGTTGGACTTGTGAT
>probe:Drosophila_2:1632919_at:238:607; Interrogation_Position=1182; Antisense; TGATGAAAGCGCTCTGGCAGACTCG
>probe:Drosophila_2:1632919_at:174:567; Interrogation_Position=1197; Antisense; GGCAGACTCGTGTATTACGCTTTAG
>probe:Drosophila_2:1632919_at:219:681; Interrogation_Position=1242; Antisense; TATGTTTCGTTCATTGCTTCATGGG
>probe:Drosophila_2:1632919_at:437:617; Interrogation_Position=681; Antisense; TGCACCGAGGAGACCTGTGGCATCA
>probe:Drosophila_2:1632919_at:564:595; Interrogation_Position=696; Antisense; TGTGGCATCATGTCGGCTGGTCCGA
>probe:Drosophila_2:1632919_at:79:165; Interrogation_Position=720; Antisense; AAATACGAGTACCACTGGGCCGACG
>probe:Drosophila_2:1632919_at:541:353; Interrogation_Position=772; Antisense; GCAGCGCGCCCAAGTATATTGACTA
>probe:Drosophila_2:1632919_at:536:39; Interrogation_Position=852; Antisense; ATCGGCGTGCCGTTTCCAAAGAACT
>probe:Drosophila_2:1632919_at:108:615; Interrogation_Position=901; Antisense; TGAAGCGTCTGTTCCGCGTGTATGC

Paste this into a BLAST search page for me
ACTTCATCTTCTTCGTGCAGGAGTTTCAATCTGATTGAGCGGCGCGAACTGAATCACTGCATGGAGCCGCGAATTGAATTTTCGCGATTCCGGCGGCGGTCTGCGCTTGCAGTTGGACTTGTGATTGATGAAAGCGCTCTGGCAGACTCGGGCAGACTCGTGTATTACGCTTTAGTATGTTTCGTTCATTGCTTCATGGGTGCACCGAGGAGACCTGTGGCATCATGTGGCATCATGTCGGCTGGTCCGAAAATACGAGTACCACTGGGCCGACGGCAGCGCGCCCAAGTATATTGACTAATCGGCGTGCCGTTTCCAAAGAACTTGAAGCGTCTGTTCCGCGTGTATGC

Full Affymetrix probeset data:

Annotations for 1632919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720