Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632920_at:

>probe:Drosophila_2:1632920_at:292:677; Interrogation_Position=1077; Antisense; TAGAATTCCCTGTAATCTGCTCATT
>probe:Drosophila_2:1632920_at:182:187; Interrogation_Position=1123; Antisense; AACACGGATTTTCTCCAGCGGAGTG
>probe:Drosophila_2:1632920_at:687:231; Interrogation_Position=1159; Antisense; AATCCCAATGGCTCCGTGGATGTTA
>probe:Drosophila_2:1632920_at:514:519; Interrogation_Position=1174; Antisense; GTGGATGTTAACGACTTTCTGCAGA
>probe:Drosophila_2:1632920_at:44:467; Interrogation_Position=1289; Antisense; GATTGGCGCAATACCACGGACGCAT
>probe:Drosophila_2:1632920_at:35:141; Interrogation_Position=1304; Antisense; ACGGACGCATTGCTGCACTGAACAT
>probe:Drosophila_2:1632920_at:121:585; Interrogation_Position=1349; Antisense; TGGAAGCCATTCCTTTTTTCTACAC
>probe:Drosophila_2:1632920_at:695:155; Interrogation_Position=1370; Antisense; ACACCGTGATATTCGGCAGGGCCTT
>probe:Drosophila_2:1632920_at:469:337; Interrogation_Position=1397; Antisense; GCTCCGCAGGATATGGACCTTTCAA
>probe:Drosophila_2:1632920_at:552:413; Interrogation_Position=1412; Antisense; GACCTTTCAAGGACGTTGTCATCGA
>probe:Drosophila_2:1632920_at:553:543; Interrogation_Position=1449; Antisense; GGATTTGCAGTTCGTAGCCTACTTC
>probe:Drosophila_2:1632920_at:696:125; Interrogation_Position=1464; Antisense; AGCCTACTTCTTTGATGACTACGAC
>probe:Drosophila_2:1632920_at:452:729; Interrogation_Position=1567; Antisense; TTGTGTCGGTGTCAGATCGTCGATC
>probe:Drosophila_2:1632920_at:299:519; Interrogation_Position=1597; Antisense; GGGCGAAATTACTGGCTCACGAAGT

Paste this into a BLAST search page for me
TAGAATTCCCTGTAATCTGCTCATTAACACGGATTTTCTCCAGCGGAGTGAATCCCAATGGCTCCGTGGATGTTAGTGGATGTTAACGACTTTCTGCAGAGATTGGCGCAATACCACGGACGCATACGGACGCATTGCTGCACTGAACATTGGAAGCCATTCCTTTTTTCTACACACACCGTGATATTCGGCAGGGCCTTGCTCCGCAGGATATGGACCTTTCAAGACCTTTCAAGGACGTTGTCATCGAGGATTTGCAGTTCGTAGCCTACTTCAGCCTACTTCTTTGATGACTACGACTTGTGTCGGTGTCAGATCGTCGATCGGGCGAAATTACTGGCTCACGAAGT

Full Affymetrix probeset data:

Annotations for 1632920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime