FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632921_at:

>probe:Drosophila_2:1632921_at:84:371; Interrogation_Position=134; Antisense; GAATGGATGTTCTAGGACTCTCGCC
>probe:Drosophila_2:1632921_at:236:411; Interrogation_Position=194; Antisense; GACGCACGAGTTTTTTGCTGTACCA
>probe:Drosophila_2:1632921_at:75:367; Interrogation_Position=20; Antisense; GAATCAGTGGAAGTTCCCAGCCGCG
>probe:Drosophila_2:1632921_at:176:691; Interrogation_Position=225; Antisense; TTTGGCCATAAATTCAGCCGCCGGC
>probe:Drosophila_2:1632921_at:381:577; Interrogation_Position=342; Antisense; GGCCGCCATGGCGAATGAGTTTCAG
>probe:Drosophila_2:1632921_at:188:85; Interrogation_Position=367; Antisense; AGTGTGCCAGTGTACGAGACCTTTC
>probe:Drosophila_2:1632921_at:162:695; Interrogation_Position=388; Antisense; TTTCCGGCGGACTTGCAGAACTGGC
>probe:Drosophila_2:1632921_at:578:661; Interrogation_Position=424; Antisense; TACGGGATCAGTGCCACGGATTTCT
>probe:Drosophila_2:1632921_at:416:139; Interrogation_Position=439; Antisense; ACGGATTTCTACCACAGCTGGAGCA
>probe:Drosophila_2:1632921_at:289:355; Interrogation_Position=494; Antisense; GCACCCAGCTGATCTGTACGGCAGA
>probe:Drosophila_2:1632921_at:143:441; Interrogation_Position=517; Antisense; GATGGCCAGTGCTATGAGGTCAACA
>probe:Drosophila_2:1632921_at:158:535; Interrogation_Position=534; Antisense; GGTCAACAAAATCGTCACTGCCTGC
>probe:Drosophila_2:1632921_at:9:23; Interrogation_Position=54; Antisense; ATATATATTCTTGTGCCTGATGGCG
>probe:Drosophila_2:1632921_at:603:67; Interrogation_Position=73; Antisense; ATGGCGTCGGTGTTTGCTTCATTAC

Paste this into a BLAST search page for me
GAATGGATGTTCTAGGACTCTCGCCGACGCACGAGTTTTTTGCTGTACCAGAATCAGTGGAAGTTCCCAGCCGCGTTTGGCCATAAATTCAGCCGCCGGCGGCCGCCATGGCGAATGAGTTTCAGAGTGTGCCAGTGTACGAGACCTTTCTTTCCGGCGGACTTGCAGAACTGGCTACGGGATCAGTGCCACGGATTTCTACGGATTTCTACCACAGCTGGAGCAGCACCCAGCTGATCTGTACGGCAGAGATGGCCAGTGCTATGAGGTCAACAGGTCAACAAAATCGTCACTGCCTGCATATATATTCTTGTGCCTGATGGCGATGGCGTCGGTGTTTGCTTCATTAC

Full Affymetrix probeset data:

Annotations for 1632921_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720