Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632922_at:

>probe:Drosophila_2:1632922_at:339:229; Interrogation_Position=5313; Antisense; AATGATGAACTTATCTCAAAAGGTT
>probe:Drosophila_2:1632922_at:436:229; Interrogation_Position=5348; Antisense; AATGATAACGACTGCCATATACCTA
>probe:Drosophila_2:1632922_at:153:199; Interrogation_Position=5354; Antisense; AACGACTGCCATATACCTATGAAAT
>probe:Drosophila_2:1632922_at:148:23; Interrogation_Position=5377; Antisense; ATATGAAGTGAAATCCCGAAAGTGA
>probe:Drosophila_2:1632922_at:622:389; Interrogation_Position=5420; Antisense; GAAAAATTCAGTTATCAACCTTGAA
>probe:Drosophila_2:1632922_at:75:165; Interrogation_Position=5482; Antisense; AAATGTTGATTACGCTCTTTGCTGG
>probe:Drosophila_2:1632922_at:718:461; Interrogation_Position=5489; Antisense; GATTACGCTCTTTGCTGGAAGACCT
>probe:Drosophila_2:1632922_at:172:299; Interrogation_Position=5494; Antisense; CGCTCTTTGCTGGAAGACCTATTTT
>probe:Drosophila_2:1632922_at:185:623; Interrogation_Position=5501; Antisense; TGCTGGAAGACCTATTTTTATAATT
>probe:Drosophila_2:1632922_at:226:639; Interrogation_Position=5529; Antisense; TCTGATTTGAAAACTTCCTTTTTAT
>probe:Drosophila_2:1632922_at:154:203; Interrogation_Position=5587; Antisense; AAGCCTAACTAAATGTTTTGGCAGT
>probe:Drosophila_2:1632922_at:593:667; Interrogation_Position=5697; Antisense; TACATATTATGTGTAGCTACGAATA
>probe:Drosophila_2:1632922_at:90:49; Interrogation_Position=5730; Antisense; ATGCGAGAAATTCCAAAAGACTTTT
>probe:Drosophila_2:1632922_at:560:613; Interrogation_Position=5818; Antisense; TGAAGGAACGACGAACACACACAAA

Paste this into a BLAST search page for me
AATGATGAACTTATCTCAAAAGGTTAATGATAACGACTGCCATATACCTAAACGACTGCCATATACCTATGAAATATATGAAGTGAAATCCCGAAAGTGAGAAAAATTCAGTTATCAACCTTGAAAAATGTTGATTACGCTCTTTGCTGGGATTACGCTCTTTGCTGGAAGACCTCGCTCTTTGCTGGAAGACCTATTTTTGCTGGAAGACCTATTTTTATAATTTCTGATTTGAAAACTTCCTTTTTATAAGCCTAACTAAATGTTTTGGCAGTTACATATTATGTGTAGCTACGAATAATGCGAGAAATTCCAAAAGACTTTTTGAAGGAACGACGAACACACACAAA

Full Affymetrix probeset data:

Annotations for 1632922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime