Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632923_at:

>probe:Drosophila_2:1632923_at:109:563; Interrogation_Position=183; Antisense; GGAACTGAACGTACCGCCGCTAGAG
>probe:Drosophila_2:1632923_at:396:125; Interrogation_Position=206; Antisense; AGCCCCTCTACATTGGAGATCTGAG
>probe:Drosophila_2:1632923_at:65:41; Interrogation_Position=224; Antisense; ATCTGAGCATTCTGGATGGATCCGC
>probe:Drosophila_2:1632923_at:729:253; Interrogation_Position=328; Antisense; CAAAACCGACGCTTTGACTTCGAGT
>probe:Drosophila_2:1632923_at:280:723; Interrogation_Position=341; Antisense; TTGACTTCGAGTTGATTCTGCCCCA
>probe:Drosophila_2:1632923_at:157:595; Interrogation_Position=378; Antisense; TGGGCTCTACGAGATCAACGGCAAT
>probe:Drosophila_2:1632923_at:591:227; Interrogation_Position=427; Antisense; AATGGGCCGTTCACTGGAAACTTCA
>probe:Drosophila_2:1632923_at:176:311; Interrogation_Position=452; Antisense; CCAACTTTGTGGCTTATGTGCGCGT
>probe:Drosophila_2:1632923_at:707:61; Interrogation_Position=467; Antisense; ATGTGCGCGTCCAGTACGACATTAA
>probe:Drosophila_2:1632923_at:512:75; Interrogation_Position=524; Antisense; AGGAGTTCGTCCTGAAGATCCGCAC
>probe:Drosophila_2:1632923_at:62:561; Interrogation_Position=556; Antisense; GGAAACCTGAAGCTGGAGAACCTCT
>probe:Drosophila_2:1632923_at:600:435; Interrogation_Position=637; Antisense; GAGGTCTTCACCAACGACTTGATCG
>probe:Drosophila_2:1632923_at:611:69; Interrogation_Position=683; Antisense; AGGCCAAGTTTCTGGTCATCACGAC
>probe:Drosophila_2:1632923_at:53:235; Interrogation_Position=711; Antisense; AATCCTTGAGAACTTCACCTACAGC

Paste this into a BLAST search page for me
GGAACTGAACGTACCGCCGCTAGAGAGCCCCTCTACATTGGAGATCTGAGATCTGAGCATTCTGGATGGATCCGCCAAAACCGACGCTTTGACTTCGAGTTTGACTTCGAGTTGATTCTGCCCCATGGGCTCTACGAGATCAACGGCAATAATGGGCCGTTCACTGGAAACTTCACCAACTTTGTGGCTTATGTGCGCGTATGTGCGCGTCCAGTACGACATTAAAGGAGTTCGTCCTGAAGATCCGCACGGAAACCTGAAGCTGGAGAACCTCTGAGGTCTTCACCAACGACTTGATCGAGGCCAAGTTTCTGGTCATCACGACAATCCTTGAGAACTTCACCTACAGC

Full Affymetrix probeset data:

Annotations for 1632923_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime