FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632924_at:

>probe:Drosophila_2:1632924_at:121:643; Interrogation_Position=127; Antisense; TCAAGCCGTAATCAAAACCCAGCCA
>probe:Drosophila_2:1632924_at:52:177; Interrogation_Position=323; Antisense; AAACGCAAAGCGGATTCATTCGGAG
>probe:Drosophila_2:1632924_at:706:295; Interrogation_Position=326; Antisense; CGCAAAGCGGATTCATTCGGAGTTT
>probe:Drosophila_2:1632924_at:686:253; Interrogation_Position=328; Antisense; CAAAGCGGATTCATTCGGAGTTTTT
>probe:Drosophila_2:1632924_at:377:203; Interrogation_Position=330; Antisense; AAGCGGATTCATTCGGAGTTTTTAT
>probe:Drosophila_2:1632924_at:435:121; Interrogation_Position=331; Antisense; AGCGGATTCATTCGGAGTTTTTATT
>probe:Drosophila_2:1632924_at:680:537; Interrogation_Position=334; Antisense; GGATTCATTCGGAGTTTTTATTTAT
>probe:Drosophila_2:1632924_at:108:645; Interrogation_Position=338; Antisense; TCATTCGGAGTTTTTATTTATTTCG
>probe:Drosophila_2:1632924_at:300:701; Interrogation_Position=348; Antisense; TTTTTATTTATTTCGGCGTTGATCT
>probe:Drosophila_2:1632924_at:73:701; Interrogation_Position=355; Antisense; TTATTTCGGCGTTGATCTTAGTTCA
>probe:Drosophila_2:1632924_at:221:15; Interrogation_Position=357; Antisense; ATTTCGGCGTTGATCTTAGTTCAAA
>probe:Drosophila_2:1632924_at:673:443; Interrogation_Position=81; Antisense; GATTCCTCGTTAAATAAACAAACAT
>probe:Drosophila_2:1632924_at:372:187; Interrogation_Position=97; Antisense; AACAAACATTTCTCGATATTGCGCA
>probe:Drosophila_2:1632924_at:392:159; Interrogation_Position=98; Antisense; ACAAACATTTCTCGATATTGCGCAT

Paste this into a BLAST search page for me
TCAAGCCGTAATCAAAACCCAGCCAAAACGCAAAGCGGATTCATTCGGAGCGCAAAGCGGATTCATTCGGAGTTTCAAAGCGGATTCATTCGGAGTTTTTAAGCGGATTCATTCGGAGTTTTTATAGCGGATTCATTCGGAGTTTTTATTGGATTCATTCGGAGTTTTTATTTATTCATTCGGAGTTTTTATTTATTTCGTTTTTATTTATTTCGGCGTTGATCTTTATTTCGGCGTTGATCTTAGTTCAATTTCGGCGTTGATCTTAGTTCAAAGATTCCTCGTTAAATAAACAAACATAACAAACATTTCTCGATATTGCGCAACAAACATTTCTCGATATTGCGCAT

Full Affymetrix probeset data:

Annotations for 1632924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720