FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632925_at:

>probe:Drosophila_2:1632925_at:674:367; Interrogation_Position=1060; Antisense; GAATCCCTAATGTCGTGGCGCATTC
>probe:Drosophila_2:1632925_at:612:323; Interrogation_Position=1077; Antisense; GCGCATTCAGGCCAAGATTCAGTTC
>probe:Drosophila_2:1632925_at:71:579; Interrogation_Position=1108; Antisense; GGCCTAGATGTTGTGCTTAGCCGCA
>probe:Drosophila_2:1632925_at:205:539; Interrogation_Position=1141; Antisense; GGTTTGTTTACATCGATTCTGGTCA
>probe:Drosophila_2:1632925_at:296:589; Interrogation_Position=1160; Antisense; TGGTCAATTACCTGCTCATACTCAT
>probe:Drosophila_2:1632925_at:55:709; Interrogation_Position=665; Antisense; TTAACTGGCGATTTCCTCAGCTGCA
>probe:Drosophila_2:1632925_at:247:345; Interrogation_Position=704; Antisense; GCATACGCCAGGTGGTTTCCATGAT
>probe:Drosophila_2:1632925_at:285:553; Interrogation_Position=732; Antisense; GGAGCTGCACTATCTCATCCAGGAG
>probe:Drosophila_2:1632925_at:311:81; Interrogation_Position=755; Antisense; AGATTAACCGAGTTTACGCCCTCAG
>probe:Drosophila_2:1632925_at:39:41; Interrogation_Position=803; Antisense; ATCTGGCCATGAGCACGAGTGAGTT
>probe:Drosophila_2:1632925_at:501:607; Interrogation_Position=822; Antisense; TGAGTTGTACATCCTGTTTGGCCAG
>probe:Drosophila_2:1632925_at:336:351; Interrogation_Position=884; Antisense; GCAGTTGCTATCGAATGCTCGGCTA
>probe:Drosophila_2:1632925_at:437:571; Interrogation_Position=904; Antisense; GGCTATTTGGCCCTAGTCATGATCC
>probe:Drosophila_2:1632925_at:153:27; Interrogation_Position=949; Antisense; ATAGCTCCATTCTATTGCGATCGCA

Paste this into a BLAST search page for me
GAATCCCTAATGTCGTGGCGCATTCGCGCATTCAGGCCAAGATTCAGTTCGGCCTAGATGTTGTGCTTAGCCGCAGGTTTGTTTACATCGATTCTGGTCATGGTCAATTACCTGCTCATACTCATTTAACTGGCGATTTCCTCAGCTGCAGCATACGCCAGGTGGTTTCCATGATGGAGCTGCACTATCTCATCCAGGAGAGATTAACCGAGTTTACGCCCTCAGATCTGGCCATGAGCACGAGTGAGTTTGAGTTGTACATCCTGTTTGGCCAGGCAGTTGCTATCGAATGCTCGGCTAGGCTATTTGGCCCTAGTCATGATCCATAGCTCCATTCTATTGCGATCGCA

Full Affymetrix probeset data:

Annotations for 1632925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720