FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632926_at:

>probe:Drosophila_2:1632926_at:135:645; Interrogation_Position=122; Antisense; TCTTCAGCAGCGACCTGAGGGACGA
>probe:Drosophila_2:1632926_at:458:607; Interrogation_Position=137; Antisense; TGAGGGACGACTTCTATCGGGATGT
>probe:Drosophila_2:1632926_at:42:661; Interrogation_Position=17; Antisense; TAACGAGGCTCTACAACACCGAAGA
>probe:Drosophila_2:1632926_at:438:565; Interrogation_Position=189; Antisense; GGAATACTGCTATGGCCTGGTGCTG
>probe:Drosophila_2:1632926_at:526:623; Interrogation_Position=223; Antisense; TGCGCCATGGGCATCATAGGCAACG
>probe:Drosophila_2:1632926_at:186:5; Interrogation_Position=238; Antisense; ATAGGCAACGTGCTCAACCTGGTTG
>probe:Drosophila_2:1632926_at:137:589; Interrogation_Position=257; Antisense; TGGTTGTGCTCACCAGGCGCAACAT
>probe:Drosophila_2:1632926_at:435:519; Interrogation_Position=284; Antisense; GTGGCACCGCCTACATTTACATGCG
>probe:Drosophila_2:1632926_at:252:387; Interrogation_Position=310; Antisense; GAAAATATTCCACACATCAACATCG
>probe:Drosophila_2:1632926_at:296:23; Interrogation_Position=336; Antisense; ATGTAGACACACTCGTACGTCTTCG
>probe:Drosophila_2:1632926_at:546:175; Interrogation_Position=368; Antisense; AAACCTTGGATTTCCTCATCTTCAT
>probe:Drosophila_2:1632926_at:532:271; Interrogation_Position=384; Antisense; CATCTTCATTGGCATTCCGGGTGAT
>probe:Drosophila_2:1632926_at:349:81; Interrogation_Position=472; Antisense; AGGGAATTGGGCTCGACTCTTGACT
>probe:Drosophila_2:1632926_at:308:367; Interrogation_Position=75; Antisense; GAATCTCACCAGCAGCGTCGACGTC

Paste this into a BLAST search page for me
TCTTCAGCAGCGACCTGAGGGACGATGAGGGACGACTTCTATCGGGATGTTAACGAGGCTCTACAACACCGAAGAGGAATACTGCTATGGCCTGGTGCTGTGCGCCATGGGCATCATAGGCAACGATAGGCAACGTGCTCAACCTGGTTGTGGTTGTGCTCACCAGGCGCAACATGTGGCACCGCCTACATTTACATGCGGAAAATATTCCACACATCAACATCGATGTAGACACACTCGTACGTCTTCGAAACCTTGGATTTCCTCATCTTCATCATCTTCATTGGCATTCCGGGTGATAGGGAATTGGGCTCGACTCTTGACTGAATCTCACCAGCAGCGTCGACGTC

Full Affymetrix probeset data:

Annotations for 1632926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720