FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632927_at:

>probe:Drosophila_2:1632927_at:238:329; Interrogation_Position=1058; Antisense; GCGTCAAATAGTTTTCTCATAGTAA
>probe:Drosophila_2:1632927_at:38:493; Interrogation_Position=1079; Antisense; GTAACTTCTGTGTTTTGCGCAATGT
>probe:Drosophila_2:1632927_at:577:43; Interrogation_Position=623; Antisense; ATCGCATATATTCCACAGTTACCAT
>probe:Drosophila_2:1632927_at:327:35; Interrogation_Position=646; Antisense; ATCAGATCCACCCTGCAGTACAAAT
>probe:Drosophila_2:1632927_at:613:349; Interrogation_Position=660; Antisense; GCAGTACAAATACCGCCTACTTGTC
>probe:Drosophila_2:1632927_at:586:665; Interrogation_Position=677; Antisense; TACTTGTCCGCCGATCCTGATCAGG
>probe:Drosophila_2:1632927_at:624:33; Interrogation_Position=696; Antisense; ATCAGGCCTTCTTCGACACCATTAA
>probe:Drosophila_2:1632927_at:253:157; Interrogation_Position=711; Antisense; ACACCATTAAGCCTCACATGCAGCA
>probe:Drosophila_2:1632927_at:148:53; Interrogation_Position=728; Antisense; ATGCAGCAGATGTGCGCCGATCGCA
>probe:Drosophila_2:1632927_at:186:319; Interrogation_Position=743; Antisense; GCCGATCGCAAGCTTGACTTTCAGA
>probe:Drosophila_2:1632927_at:42:345; Interrogation_Position=754; Antisense; GCTTGACTTTCAGATCGAGGTCCTG
>probe:Drosophila_2:1632927_at:729:433; Interrogation_Position=770; Antisense; GAGGTCCTGAAAATCCTACGAAACT
>probe:Drosophila_2:1632927_at:227:237; Interrogation_Position=905; Antisense; AATCGTTATCGTAAATCGTCTAATC
>probe:Drosophila_2:1632927_at:510:235; Interrogation_Position=918; Antisense; AATCGTCTAATCTTTAGGGCGCGAA

Paste this into a BLAST search page for me
GCGTCAAATAGTTTTCTCATAGTAAGTAACTTCTGTGTTTTGCGCAATGTATCGCATATATTCCACAGTTACCATATCAGATCCACCCTGCAGTACAAATGCAGTACAAATACCGCCTACTTGTCTACTTGTCCGCCGATCCTGATCAGGATCAGGCCTTCTTCGACACCATTAAACACCATTAAGCCTCACATGCAGCAATGCAGCAGATGTGCGCCGATCGCAGCCGATCGCAAGCTTGACTTTCAGAGCTTGACTTTCAGATCGAGGTCCTGGAGGTCCTGAAAATCCTACGAAACTAATCGTTATCGTAAATCGTCTAATCAATCGTCTAATCTTTAGGGCGCGAA

Full Affymetrix probeset data:

Annotations for 1632927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720