FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632930_at:

>probe:Drosophila_2:1632930_at:511:85; Interrogation_Position=1125; Antisense; AGTGCCTAAGCCCAAACCTGTTCTT
>probe:Drosophila_2:1632930_at:649:171; Interrogation_Position=1153; Antisense; AAAGTTTCCAAGTCAGATCTCCGCT
>probe:Drosophila_2:1632930_at:347:317; Interrogation_Position=1180; Antisense; GCCGTTCTAGCCAGTTTGGGTCAGA
>probe:Drosophila_2:1632930_at:175:61; Interrogation_Position=1208; Antisense; ATGTCCATCACTGCTACACTAATGT
>probe:Drosophila_2:1632930_at:352:657; Interrogation_Position=1227; Antisense; TAATGTGGCAGCTTATCGGCGGACC
>probe:Drosophila_2:1632930_at:341:327; Interrogation_Position=1245; Antisense; GCGGACCAAGAACTACGTCGACCTA
>probe:Drosophila_2:1632930_at:426:501; Interrogation_Position=1261; Antisense; GTCGACCTACAGCTCAGCGAGATGA
>probe:Drosophila_2:1632930_at:645:325; Interrogation_Position=1277; Antisense; GCGAGATGAAAGACCGACCCAGCAT
>probe:Drosophila_2:1632930_at:631:411; Interrogation_Position=1292; Antisense; GACCCAGCATTTCGATGTTTGCGGA
>probe:Drosophila_2:1632930_at:712:231; Interrogation_Position=745; Antisense; AATGACATTGGAATCTCCCGCTGGA
>probe:Drosophila_2:1632930_at:74:303; Interrogation_Position=761; Antisense; CCCGCTGGAGCTTTAACTTGTTGAA
>probe:Drosophila_2:1632930_at:722:471; Interrogation_Position=836; Antisense; GTTCGGCAAAGCTCCTACTGAGCAT
>probe:Drosophila_2:1632930_at:639:221; Interrogation_Position=913; Antisense; AAGTGGCCACAAACTCCTAGTGATA
>probe:Drosophila_2:1632930_at:86:711; Interrogation_Position=959; Antisense; TTAAGATAGCTCCACCAATTCCTGC

Paste this into a BLAST search page for me
AGTGCCTAAGCCCAAACCTGTTCTTAAAGTTTCCAAGTCAGATCTCCGCTGCCGTTCTAGCCAGTTTGGGTCAGAATGTCCATCACTGCTACACTAATGTTAATGTGGCAGCTTATCGGCGGACCGCGGACCAAGAACTACGTCGACCTAGTCGACCTACAGCTCAGCGAGATGAGCGAGATGAAAGACCGACCCAGCATGACCCAGCATTTCGATGTTTGCGGAAATGACATTGGAATCTCCCGCTGGACCCGCTGGAGCTTTAACTTGTTGAAGTTCGGCAAAGCTCCTACTGAGCATAAGTGGCCACAAACTCCTAGTGATATTAAGATAGCTCCACCAATTCCTGC

Full Affymetrix probeset data:

Annotations for 1632930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720