Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632931_at:

>probe:Drosophila_2:1632931_at:291:657; Interrogation_Position=1761; Antisense; TAATGCTCTTATGCTTCAGTAGTAA
>probe:Drosophila_2:1632931_at:282:343; Interrogation_Position=1773; Antisense; GCTTCAGTAGTAACCACCATTCTTA
>probe:Drosophila_2:1632931_at:383:721; Interrogation_Position=1822; Antisense; TTGCAGTTATTTTAAACGACCCATG
>probe:Drosophila_2:1632931_at:583:197; Interrogation_Position=1836; Antisense; AACGACCCATGAACAGAATTTTACA
>probe:Drosophila_2:1632931_at:700:687; Interrogation_Position=1854; Antisense; TTTTACAATCGTGAGACTGACCCTT
>probe:Drosophila_2:1632931_at:672:405; Interrogation_Position=1868; Antisense; GACTGACCCTTGCTGAAGCTATTTG
>probe:Drosophila_2:1632931_at:81:229; Interrogation_Position=1906; Antisense; AATGCACATGGTTTTCAATGCCTTA
>probe:Drosophila_2:1632931_at:630:539; Interrogation_Position=1915; Antisense; GGTTTTCAATGCCTTAGACACGTGA
>probe:Drosophila_2:1632931_at:495:675; Interrogation_Position=1929; Antisense; TAGACACGTGAAGTTAAGCTACAGT
>probe:Drosophila_2:1632931_at:119:209; Interrogation_Position=1944; Antisense; AAGCTACAGTGAAATCCTTCGGTAA
>probe:Drosophila_2:1632931_at:111:395; Interrogation_Position=1954; Antisense; GAAATCCTTCGGTAACTATGATAAA
>probe:Drosophila_2:1632931_at:581:199; Interrogation_Position=1999; Antisense; AACCGAGACTACAGCATTTTAATAT
>probe:Drosophila_2:1632931_at:398:675; Interrogation_Position=2029; Antisense; TAGACTTATTTAAACCCATCGGCAA
>probe:Drosophila_2:1632931_at:458:201; Interrogation_Position=2041; Antisense; AACCCATCGGCAAACTTAGTTATCG

Paste this into a BLAST search page for me
TAATGCTCTTATGCTTCAGTAGTAAGCTTCAGTAGTAACCACCATTCTTATTGCAGTTATTTTAAACGACCCATGAACGACCCATGAACAGAATTTTACATTTTACAATCGTGAGACTGACCCTTGACTGACCCTTGCTGAAGCTATTTGAATGCACATGGTTTTCAATGCCTTAGGTTTTCAATGCCTTAGACACGTGATAGACACGTGAAGTTAAGCTACAGTAAGCTACAGTGAAATCCTTCGGTAAGAAATCCTTCGGTAACTATGATAAAAACCGAGACTACAGCATTTTAATATTAGACTTATTTAAACCCATCGGCAAAACCCATCGGCAAACTTAGTTATCG

Full Affymetrix probeset data:

Annotations for 1632931_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime