FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632933_at:

>probe:Drosophila_2:1632933_at:503:479; Interrogation_Position=236; Antisense; GTTTGCATAGCATCAGGGAGTACCT
>probe:Drosophila_2:1632933_at:94:529; Interrogation_Position=251; Antisense; GGGAGTACCTCAACGGGATTGGCAA
>probe:Drosophila_2:1632933_at:703:3; Interrogation_Position=268; Antisense; ATTGGCAACGGTCCGGATGCACTGA
>probe:Drosophila_2:1632933_at:408:403; Interrogation_Position=298; Antisense; GACTTCAAGAACATTGTGCCCCATC
>probe:Drosophila_2:1632933_at:542:595; Interrogation_Position=342; Antisense; TGTGAAACACGATATAGCCCTCCTG
>probe:Drosophila_2:1632933_at:649:553; Interrogation_Position=366; Antisense; GGAGCTGGTACAGCCAATCCGATTC
>probe:Drosophila_2:1632933_at:632:449; Interrogation_Position=505; Antisense; GATCGATCCGATGTACTGCGCAAGG
>probe:Drosophila_2:1632933_at:520:283; Interrogation_Position=520; Antisense; CTGCGCAAGGCTACCGTTAAGATCT
>probe:Drosophila_2:1632933_at:172:199; Interrogation_Position=550; Antisense; AACGAGGCGTGCGAGAGGTCCTACC
>probe:Drosophila_2:1632933_at:102:535; Interrogation_Position=566; Antisense; GGTCCTACCGATCCTTGGGCAAGAG
>probe:Drosophila_2:1632933_at:573:397; Interrogation_Position=606; Antisense; GACACAGTTGTGTGCCGGTTATGAA
>probe:Drosophila_2:1632933_at:422:163; Interrogation_Position=638; Antisense; AAATCGACTCGTGTTGGGCGGATTC
>probe:Drosophila_2:1632933_at:202:451; Interrogation_Position=717; Antisense; GATCGGCTGTGCACGTCCAGGTTTG
>probe:Drosophila_2:1632933_at:695:73; Interrogation_Position=735; Antisense; AGGTTTGCCCGGAATCTACACGCGC

Paste this into a BLAST search page for me
GTTTGCATAGCATCAGGGAGTACCTGGGAGTACCTCAACGGGATTGGCAAATTGGCAACGGTCCGGATGCACTGAGACTTCAAGAACATTGTGCCCCATCTGTGAAACACGATATAGCCCTCCTGGGAGCTGGTACAGCCAATCCGATTCGATCGATCCGATGTACTGCGCAAGGCTGCGCAAGGCTACCGTTAAGATCTAACGAGGCGTGCGAGAGGTCCTACCGGTCCTACCGATCCTTGGGCAAGAGGACACAGTTGTGTGCCGGTTATGAAAAATCGACTCGTGTTGGGCGGATTCGATCGGCTGTGCACGTCCAGGTTTGAGGTTTGCCCGGAATCTACACGCGC

Full Affymetrix probeset data:

Annotations for 1632933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720