FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632935_at:

>probe:Drosophila_2:1632935_at:637:289; Interrogation_Position=1012; Antisense; GCCTACGAGGAACCGGAGTACCATC
>probe:Drosophila_2:1632935_at:724:615; Interrogation_Position=1049; Antisense; TGCACTCGGTCAACAGCAGTAGTTC
>probe:Drosophila_2:1632935_at:308:89; Interrogation_Position=1066; Antisense; AGTAGTTCGTTGTCCTCGATGGGAT
>probe:Drosophila_2:1632935_at:239:65; Interrogation_Position=1084; Antisense; ATGGGATCGTCATCGCTGCCACAGG
>probe:Drosophila_2:1632935_at:449:75; Interrogation_Position=1106; Antisense; AGGAGGCAAGCAATTCCCGAGCCAC
>probe:Drosophila_2:1632935_at:502:125; Interrogation_Position=1155; Antisense; AGCCACCATGGTCATAGCCAGCTGA
>probe:Drosophila_2:1632935_at:227:63; Interrogation_Position=582; Antisense; ATGGTGGTCTCGCAACAAACGCGCC
>probe:Drosophila_2:1632935_at:502:299; Interrogation_Position=601; Antisense; CGCGCCCACGGCAACGGATTGAATG
>probe:Drosophila_2:1632935_at:467:361; Interrogation_Position=665; Antisense; GCAATGTGCACCACCACAACGGCAG
>probe:Drosophila_2:1632935_at:385:547; Interrogation_Position=719; Antisense; GGAGGAGCAACATCTACACGGCCCA
>probe:Drosophila_2:1632935_at:614:399; Interrogation_Position=751; Antisense; GACAGCATACGAGGTCTGCAACCGC
>probe:Drosophila_2:1632935_at:720:187; Interrogation_Position=893; Antisense; AACAGCAGCAGTACTTCCATCCATA
>probe:Drosophila_2:1632935_at:398:115; Interrogation_Position=929; Antisense; AGCATGTGCACCACTCGCATACGCA
>probe:Drosophila_2:1632935_at:697:333; Interrogation_Position=981; Antisense; GCTGTATCCACACGACTGTGACGAG

Paste this into a BLAST search page for me
GCCTACGAGGAACCGGAGTACCATCTGCACTCGGTCAACAGCAGTAGTTCAGTAGTTCGTTGTCCTCGATGGGATATGGGATCGTCATCGCTGCCACAGGAGGAGGCAAGCAATTCCCGAGCCACAGCCACCATGGTCATAGCCAGCTGAATGGTGGTCTCGCAACAAACGCGCCCGCGCCCACGGCAACGGATTGAATGGCAATGTGCACCACCACAACGGCAGGGAGGAGCAACATCTACACGGCCCAGACAGCATACGAGGTCTGCAACCGCAACAGCAGCAGTACTTCCATCCATAAGCATGTGCACCACTCGCATACGCAGCTGTATCCACACGACTGTGACGAG

Full Affymetrix probeset data:

Annotations for 1632935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720