FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632936_at:

>probe:Drosophila_2:1632936_at:387:725; Interrogation_Position=4839; Antisense; TTGTTTTCGTTTGCGCGATTAGCGT
>probe:Drosophila_2:1632936_at:502:321; Interrogation_Position=4851; Antisense; GCGCGATTAGCGTTCGCATCGATTT
>probe:Drosophila_2:1632936_at:330:471; Interrogation_Position=4862; Antisense; GTTCGCATCGATTTGTTTAGACTGA
>probe:Drosophila_2:1632936_at:600:283; Interrogation_Position=4883; Antisense; CTGATTAGCCTAAAACGATTGCAAA
>probe:Drosophila_2:1632936_at:6:247; Interrogation_Position=4930; Antisense; AATTAATCTATTCACTCCTAGCCCT
>probe:Drosophila_2:1632936_at:663:19; Interrogation_Position=5040; Antisense; ATATTACATTACATTCACTAGCAAT
>probe:Drosophila_2:1632936_at:135:501; Interrogation_Position=5075; Antisense; GTCGAATAGGATTTCCAGGCACGGT
>probe:Drosophila_2:1632936_at:305:693; Interrogation_Position=5086; Antisense; TTTCCAGGCACGGTAAAAATAGCTC
>probe:Drosophila_2:1632936_at:127:185; Interrogation_Position=5101; Antisense; AAAATAGCTCTAATATCCGATATAC
>probe:Drosophila_2:1632936_at:124:243; Interrogation_Position=5112; Antisense; AATATCCGATATACCACTTATAGAT
>probe:Drosophila_2:1632936_at:723:95; Interrogation_Position=5133; Antisense; AGATTTAAGCTAAGCCCTCTCTCAG
>probe:Drosophila_2:1632936_at:23:281; Interrogation_Position=5151; Antisense; CTCTCAGCTCTGGTATTGTCGTATA
>probe:Drosophila_2:1632936_at:321:597; Interrogation_Position=5167; Antisense; TGTCGTATACGAGAGTCATTCAAAT
>probe:Drosophila_2:1632936_at:462:439; Interrogation_Position=5280; Antisense; GATGGGATGGATTACTTCTAACGGA

Paste this into a BLAST search page for me
TTGTTTTCGTTTGCGCGATTAGCGTGCGCGATTAGCGTTCGCATCGATTTGTTCGCATCGATTTGTTTAGACTGACTGATTAGCCTAAAACGATTGCAAAAATTAATCTATTCACTCCTAGCCCTATATTACATTACATTCACTAGCAATGTCGAATAGGATTTCCAGGCACGGTTTTCCAGGCACGGTAAAAATAGCTCAAAATAGCTCTAATATCCGATATACAATATCCGATATACCACTTATAGATAGATTTAAGCTAAGCCCTCTCTCAGCTCTCAGCTCTGGTATTGTCGTATATGTCGTATACGAGAGTCATTCAAATGATGGGATGGATTACTTCTAACGGA

Full Affymetrix probeset data:

Annotations for 1632936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720