FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632937_at:

>probe:Drosophila_2:1632937_at:180:403; Interrogation_Position=112; Antisense; GACTTGCAGAGCACTGTCCTCACTG
>probe:Drosophila_2:1632937_at:468:617; Interrogation_Position=116; Antisense; TGCAGAGCACTGTCCTCACTGTCAA
>probe:Drosophila_2:1632937_at:669:597; Interrogation_Position=126; Antisense; TGTCCTCACTGTCAACGCCAAGGAT
>probe:Drosophila_2:1632937_at:263:259; Interrogation_Position=132; Antisense; CACTGTCAACGCCAAGGATCACAAT
>probe:Drosophila_2:1632937_at:676:253; Interrogation_Position=138; Antisense; CAACGCCAAGGATCACAATGAGTGT
>probe:Drosophila_2:1632937_at:571:17; Interrogation_Position=24; Antisense; ATTTGTACGCATTGGTATTGCCGAC
>probe:Drosophila_2:1632937_at:227:671; Interrogation_Position=29; Antisense; TACGCATTGGTATTGCCGACAAAAA
>probe:Drosophila_2:1632937_at:540:7; Interrogation_Position=40; Antisense; ATTGCCGACAAAAACGATTCACCGC
>probe:Drosophila_2:1632937_at:525:395; Interrogation_Position=46; Antisense; GACAAAAACGATTCACCGCCGTATT
>probe:Drosophila_2:1632937_at:127:463; Interrogation_Position=55; Antisense; GATTCACCGCCGTATTTCGATAGAT
>probe:Drosophila_2:1632937_at:112:649; Interrogation_Position=58; Antisense; TCACCGCCGTATTTCGATAGATTTC
>probe:Drosophila_2:1632937_at:65:301; Interrogation_Position=62; Antisense; CGCCGTATTTCGATAGATTTCTGTA
>probe:Drosophila_2:1632937_at:679:455; Interrogation_Position=73; Antisense; GATAGATTTCTGTACGAAACTGAAA
>probe:Drosophila_2:1632937_at:306:43; Interrogation_Position=97; Antisense; ATCGATGAAAATGCCGACTTGCAGA

Paste this into a BLAST search page for me
GACTTGCAGAGCACTGTCCTCACTGTGCAGAGCACTGTCCTCACTGTCAATGTCCTCACTGTCAACGCCAAGGATCACTGTCAACGCCAAGGATCACAATCAACGCCAAGGATCACAATGAGTGTATTTGTACGCATTGGTATTGCCGACTACGCATTGGTATTGCCGACAAAAAATTGCCGACAAAAACGATTCACCGCGACAAAAACGATTCACCGCCGTATTGATTCACCGCCGTATTTCGATAGATTCACCGCCGTATTTCGATAGATTTCCGCCGTATTTCGATAGATTTCTGTAGATAGATTTCTGTACGAAACTGAAAATCGATGAAAATGCCGACTTGCAGA

Full Affymetrix probeset data:

Annotations for 1632937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720