FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632938_at:

>probe:Drosophila_2:1632938_at:262:231; Interrogation_Position=141; Antisense; AATGATTCGCCTGTGCGGAGATCAA
>probe:Drosophila_2:1632938_at:245:473; Interrogation_Position=22; Antisense; GTTCTAGTGCTATTGCTGGTGCTTA
>probe:Drosophila_2:1632938_at:373:367; Interrogation_Position=226; Antisense; GAATCGGTCCAGTGTTTCACCCATT
>probe:Drosophila_2:1632938_at:462:315; Interrogation_Position=251; Antisense; GCCTCTACGAGCAAATGGGTCTCAT
>probe:Drosophila_2:1632938_at:407:531; Interrogation_Position=267; Antisense; GGGTCTCATGCACGATGGTGTTTTT
>probe:Drosophila_2:1632938_at:382:517; Interrogation_Position=292; Antisense; GTGGAACGCGATCTATTCGGGCTTC
>probe:Drosophila_2:1632938_at:399:525; Interrogation_Position=310; Antisense; GGGCTTCTTTCCGATGTCAGTAATA
>probe:Drosophila_2:1632938_at:730:175; Interrogation_Position=331; Antisense; AATACCGATTACTGGCCAGAACGTC
>probe:Drosophila_2:1632938_at:614:381; Interrogation_Position=349; Antisense; GAACGTCAATGCCACGCGATTCGTG
>probe:Drosophila_2:1632938_at:25:425; Interrogation_Position=388; Antisense; GAGACGGCCTACAGGATTCATCAAT
>probe:Drosophila_2:1632938_at:253:359; Interrogation_Position=435; Antisense; GCAACAGAACTTATTGGCCACCAAG
>probe:Drosophila_2:1632938_at:276:231; Interrogation_Position=48; Antisense; AATGTTCGCTTTGAGCGAGTCCCGT
>probe:Drosophila_2:1632938_at:144:327; Interrogation_Position=62; Antisense; GCGAGTCCCGTTTCGCCAAGATAAA
>probe:Drosophila_2:1632938_at:34:249; Interrogation_Position=90; Antisense; CAATCTGGGACTAACCGTGGCTGAT

Paste this into a BLAST search page for me
AATGATTCGCCTGTGCGGAGATCAAGTTCTAGTGCTATTGCTGGTGCTTAGAATCGGTCCAGTGTTTCACCCATTGCCTCTACGAGCAAATGGGTCTCATGGGTCTCATGCACGATGGTGTTTTTGTGGAACGCGATCTATTCGGGCTTCGGGCTTCTTTCCGATGTCAGTAATAAATACCGATTACTGGCCAGAACGTCGAACGTCAATGCCACGCGATTCGTGGAGACGGCCTACAGGATTCATCAATGCAACAGAACTTATTGGCCACCAAGAATGTTCGCTTTGAGCGAGTCCCGTGCGAGTCCCGTTTCGCCAAGATAAACAATCTGGGACTAACCGTGGCTGAT

Full Affymetrix probeset data:

Annotations for 1632938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720