Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632939_s_at:

>probe:Drosophila_2:1632939_s_at:94:157; Interrogation_Position=402; Antisense; ACAGCCAGCCGCTAAATATCCTAAG
>probe:Drosophila_2:1632939_s_at:619:661; Interrogation_Position=414; Antisense; TAAATATCCTAAGGCCAGCTCCTTG
>probe:Drosophila_2:1632939_s_at:406:183; Interrogation_Position=534; Antisense; AACAACAACAAGTGTTGCCGGGACA
>probe:Drosophila_2:1632939_s_at:562:469; Interrogation_Position=547; Antisense; GTTGCCGGGACAACAGGAACAGCAG
>probe:Drosophila_2:1632939_s_at:62:351; Interrogation_Position=568; Antisense; GCAGTCGCAGCAAAGGCTAGCAAAA
>probe:Drosophila_2:1632939_s_at:294:227; Interrogation_Position=580; Antisense; AAGGCTAGCAAAACCACAAGCAGAA
>probe:Drosophila_2:1632939_s_at:266:137; Interrogation_Position=748; Antisense; ACGACGCTGTACACGTGCTCCAGCA
>probe:Drosophila_2:1632939_s_at:346:125; Interrogation_Position=794; Antisense; AGCCGCCGCCAACAAAGATATTTAA
>probe:Drosophila_2:1632939_s_at:142:17; Interrogation_Position=813; Antisense; ATTTAAGACGGATCACCATCTGTGC
>probe:Drosophila_2:1632939_s_at:292:213; Interrogation_Position=817; Antisense; AAGACGGATCACCATCTGTGCGCCG
>probe:Drosophila_2:1632939_s_at:712:317; Interrogation_Position=868; Antisense; GCCGCTGCTGTTGGTGGGCATCCCT
>probe:Drosophila_2:1632939_s_at:458:467; Interrogation_Position=877; Antisense; GTTGGTGGGCATCCCTGCGTCTACT
>probe:Drosophila_2:1632939_s_at:534:621; Interrogation_Position=892; Antisense; TGCGTCTACTGCGTGATACCTGTGC
>probe:Drosophila_2:1632939_s_at:683:277; Interrogation_Position=897; Antisense; CTACTGCGTGATACCTGTGCCCGTG

Paste this into a BLAST search page for me
ACAGCCAGCCGCTAAATATCCTAAGTAAATATCCTAAGGCCAGCTCCTTGAACAACAACAAGTGTTGCCGGGACAGTTGCCGGGACAACAGGAACAGCAGGCAGTCGCAGCAAAGGCTAGCAAAAAAGGCTAGCAAAACCACAAGCAGAAACGACGCTGTACACGTGCTCCAGCAAGCCGCCGCCAACAAAGATATTTAAATTTAAGACGGATCACCATCTGTGCAAGACGGATCACCATCTGTGCGCCGGCCGCTGCTGTTGGTGGGCATCCCTGTTGGTGGGCATCCCTGCGTCTACTTGCGTCTACTGCGTGATACCTGTGCCTACTGCGTGATACCTGTGCCCGTG

Full Affymetrix probeset data:

Annotations for 1632939_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime