Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632940_a_at:

>probe:Drosophila_2:1632940_a_at:348:239; Interrogation_Position=1010; Antisense; AATCAAAAGCTGTGCATGCCCTTCA
>probe:Drosophila_2:1632940_a_at:350:49; Interrogation_Position=1025; Antisense; ATGCCCTTCAATTCGGAGGCGGCCA
>probe:Drosophila_2:1632940_a_at:547:139; Interrogation_Position=1076; Antisense; ACGGAGTACGCTGTTGTTGGCACGT
>probe:Drosophila_2:1632940_a_at:637:31; Interrogation_Position=1115; Antisense; ATAACGCTCTCCGTTTTGGAGGCAT
>probe:Drosophila_2:1632940_a_at:483:437; Interrogation_Position=1133; Antisense; GAGGCATATATACCGCGTTATTTCC
>probe:Drosophila_2:1632940_a_at:728:307; Interrogation_Position=1163; Antisense; GCCAAAGTGGCCTACTACTTGGGAA
>probe:Drosophila_2:1632940_a_at:66:231; Interrogation_Position=1217; Antisense; AATGTCACTCGAATCGTCAGCGATG
>probe:Drosophila_2:1632940_a_at:111:263; Interrogation_Position=1304; Antisense; CAGCGTTTGTATCTTCAGTATGCCG
>probe:Drosophila_2:1632940_a_at:634:89; Interrogation_Position=1320; Antisense; AGTATGCCGCCCTAAGTCATGGAAA
>probe:Drosophila_2:1632940_a_at:348:1; Interrogation_Position=812; Antisense; ATTAGGGCTCCGTGGTACTATCGCG
>probe:Drosophila_2:1632940_a_at:366:669; Interrogation_Position=827; Antisense; TACTATCGCGATATGCAGGCCAAAT
>probe:Drosophila_2:1632940_a_at:445:93; Interrogation_Position=885; Antisense; AGTTCATGAACCTCGATCTGGACAC
>probe:Drosophila_2:1632940_a_at:71:559; Interrogation_Position=904; Antisense; GGACACCTGTGTGCGGAATCACGAT
>probe:Drosophila_2:1632940_a_at:545:103; Interrogation_Position=987; Antisense; AGACGCTCTTCTTCTGCGGCATGAA

Paste this into a BLAST search page for me
AATCAAAAGCTGTGCATGCCCTTCAATGCCCTTCAATTCGGAGGCGGCCAACGGAGTACGCTGTTGTTGGCACGTATAACGCTCTCCGTTTTGGAGGCATGAGGCATATATACCGCGTTATTTCCGCCAAAGTGGCCTACTACTTGGGAAAATGTCACTCGAATCGTCAGCGATGCAGCGTTTGTATCTTCAGTATGCCGAGTATGCCGCCCTAAGTCATGGAAAATTAGGGCTCCGTGGTACTATCGCGTACTATCGCGATATGCAGGCCAAATAGTTCATGAACCTCGATCTGGACACGGACACCTGTGTGCGGAATCACGATAGACGCTCTTCTTCTGCGGCATGAA

Full Affymetrix probeset data:

Annotations for 1632940_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime