FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632942_at:

>probe:Drosophila_2:1632942_at:362:623; Interrogation_Position=14; Antisense; TCAGTTACCTTACGAATCTTCTCAC
>probe:Drosophila_2:1632942_at:592:705; Interrogation_Position=18; Antisense; TTACCTTACGAATCTTCTCACGCAA
>probe:Drosophila_2:1632942_at:526:705; Interrogation_Position=23; Antisense; TTACGAATCTTCTCACGCAATCAGC
>probe:Drosophila_2:1632942_at:585:235; Interrogation_Position=28; Antisense; AATCTTCTCACGCAATCAGCAGCAC
>probe:Drosophila_2:1632942_at:444:145; Interrogation_Position=379; Antisense; ACTCCGCTCCTGTGGTGCACTCGGT
>probe:Drosophila_2:1632942_at:148:361; Interrogation_Position=39; Antisense; GCAATCAGCAGCACTCGCTTTAAAG
>probe:Drosophila_2:1632942_at:312:133; Interrogation_Position=459; Antisense; ACCCTGCACCACTAAAGCGTTCAAA
>probe:Drosophila_2:1632942_at:645:351; Interrogation_Position=46; Antisense; GCAGCACTCGCTTTAAAGATACCAA
>probe:Drosophila_2:1632942_at:66:43; Interrogation_Position=466; Antisense; ACCACTAAAGCGTTCAAATTGTTTG
>probe:Drosophila_2:1632942_at:666:647; Interrogation_Position=479; Antisense; TCAAATTGTTTGTTTGTTAACCAAT
>probe:Drosophila_2:1632942_at:352:215; Interrogation_Position=531; Antisense; AAGTATTATTGATCCTAAATTATGA
>probe:Drosophila_2:1632942_at:157:457; Interrogation_Position=63; Antisense; GATACCAATATCAAAATGTTCAAAT
>probe:Drosophila_2:1632942_at:650:471; Interrogation_Position=80; Antisense; GTTCAAATTTATCGGCGTCATCGCT
>probe:Drosophila_2:1632942_at:675:243; Interrogation_Position=85; Antisense; AATTTATCGGCGTCATCGCTCTCCT

Paste this into a BLAST search page for me
TCAGTTACCTTACGAATCTTCTCACTTACCTTACGAATCTTCTCACGCAATTACGAATCTTCTCACGCAATCAGCAATCTTCTCACGCAATCAGCAGCACACTCCGCTCCTGTGGTGCACTCGGTGCAATCAGCAGCACTCGCTTTAAAGACCCTGCACCACTAAAGCGTTCAAAGCAGCACTCGCTTTAAAGATACCAAACCACTAAAGCGTTCAAATTGTTTGTCAAATTGTTTGTTTGTTAACCAATAAGTATTATTGATCCTAAATTATGAGATACCAATATCAAAATGTTCAAATGTTCAAATTTATCGGCGTCATCGCTAATTTATCGGCGTCATCGCTCTCCT

Full Affymetrix probeset data:

Annotations for 1632942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720