Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632945_at:

>probe:Drosophila_2:1632945_at:672:201; Interrogation_Position=11459; Antisense; AACCTCGGGTGGTCAGCCTGCAGGA
>probe:Drosophila_2:1632945_at:605:351; Interrogation_Position=11523; Antisense; GCAGCAATCGCAACACACGTACGAG
>probe:Drosophila_2:1632945_at:208:421; Interrogation_Position=11547; Antisense; GAGAACCCTTTCCAGATTGACCGAT
>probe:Drosophila_2:1632945_at:194:499; Interrogation_Position=11600; Antisense; GTCTATCCGGCATCTATATCGTCAA
>probe:Drosophila_2:1632945_at:95:687; Interrogation_Position=11614; Antisense; TATATCGTCAAGCTGGGTGCCGTCC
>probe:Drosophila_2:1632945_at:449:83; Interrogation_Position=11648; Antisense; AGGGCGACAATCTCGGCGTGCCATT
>probe:Drosophila_2:1632945_at:524:627; Interrogation_Position=11666; Antisense; TGCCATTGCACATGTTGTCTAGTGA
>probe:Drosophila_2:1632945_at:722:27; Interrogation_Position=11702; Antisense; ATACTACATTATCAACCTCTTCCAT
>probe:Drosophila_2:1632945_at:35:233; Interrogation_Position=11752; Antisense; AATGCAAACAACACCGATGGCGGCG
>probe:Drosophila_2:1632945_at:93:575; Interrogation_Position=11788; Antisense; GGCGATGTCATCAATACCACGGTTC
>probe:Drosophila_2:1632945_at:719:11; Interrogation_Position=11863; Antisense; ATTCAGGCGCTCATGCTGCTGCTTT
>probe:Drosophila_2:1632945_at:177:591; Interrogation_Position=11903; Antisense; TGGTGCCCCACGGTGAGGACTACAC
>probe:Drosophila_2:1632945_at:661:73; Interrogation_Position=11918; Antisense; AGGACTACACCTGTATGTTCTCCAA
>probe:Drosophila_2:1632945_at:334:311; Interrogation_Position=11991; Antisense; GCCACCCACGTAAAGCTGTCGAGTT

Paste this into a BLAST search page for me
AACCTCGGGTGGTCAGCCTGCAGGAGCAGCAATCGCAACACACGTACGAGGAGAACCCTTTCCAGATTGACCGATGTCTATCCGGCATCTATATCGTCAATATATCGTCAAGCTGGGTGCCGTCCAGGGCGACAATCTCGGCGTGCCATTTGCCATTGCACATGTTGTCTAGTGAATACTACATTATCAACCTCTTCCATAATGCAAACAACACCGATGGCGGCGGGCGATGTCATCAATACCACGGTTCATTCAGGCGCTCATGCTGCTGCTTTTGGTGCCCCACGGTGAGGACTACACAGGACTACACCTGTATGTTCTCCAAGCCACCCACGTAAAGCTGTCGAGTT

Full Affymetrix probeset data:

Annotations for 1632945_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime