Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632946_at:

>probe:Drosophila_2:1632946_at:405:107; Interrogation_Position=1299; Antisense; AGAACATCCTGAAAGTGCGCTAATA
>probe:Drosophila_2:1632946_at:498:53; Interrogation_Position=1343; Antisense; ATGATACGTTTATGCTTAGCTCTGG
>probe:Drosophila_2:1632946_at:357:705; Interrogation_Position=1358; Antisense; TTAGCTCTGGGTGCCTTATTAAGGA
>probe:Drosophila_2:1632946_at:13:53; Interrogation_Position=1392; Antisense; ATGCGGCTATGCGACTATAATTTCC
>probe:Drosophila_2:1632946_at:226:653; Interrogation_Position=1409; Antisense; TAATTTCCGCTTTTGGTCTAGGTGA
>probe:Drosophila_2:1632946_at:3:681; Interrogation_Position=1427; Antisense; TAGGTGAGCTTCCTATCCGGTTCTT
>probe:Drosophila_2:1632946_at:626:471; Interrogation_Position=1446; Antisense; GTTCTTTCCTAATCATGCCGTCTTG
>probe:Drosophila_2:1632946_at:637:625; Interrogation_Position=1461; Antisense; TGCCGTCTTGGCATCAAGTCATAAT
>probe:Drosophila_2:1632946_at:460:497; Interrogation_Position=1478; Antisense; GTCATAATTCTTTTTGTCTCCGAGC
>probe:Drosophila_2:1632946_at:434:665; Interrogation_Position=1594; Antisense; TACTCTTTATCCTCGTATTTGTCGC
>probe:Drosophila_2:1632946_at:205:687; Interrogation_Position=1609; Antisense; TATTTGTCGCCAACATTTAGCCACC
>probe:Drosophila_2:1632946_at:92:663; Interrogation_Position=1642; Antisense; TAAACACAACCCTTAATGCGCTTCA
>probe:Drosophila_2:1632946_at:433:51; Interrogation_Position=1657; Antisense; ATGCGCTTCAAACTGCATCAGTCAG
>probe:Drosophila_2:1632946_at:349:239; Interrogation_Position=1755; Antisense; AATCAAAAGCTTCTGGCCCATCAGG

Paste this into a BLAST search page for me
AGAACATCCTGAAAGTGCGCTAATAATGATACGTTTATGCTTAGCTCTGGTTAGCTCTGGGTGCCTTATTAAGGAATGCGGCTATGCGACTATAATTTCCTAATTTCCGCTTTTGGTCTAGGTGATAGGTGAGCTTCCTATCCGGTTCTTGTTCTTTCCTAATCATGCCGTCTTGTGCCGTCTTGGCATCAAGTCATAATGTCATAATTCTTTTTGTCTCCGAGCTACTCTTTATCCTCGTATTTGTCGCTATTTGTCGCCAACATTTAGCCACCTAAACACAACCCTTAATGCGCTTCAATGCGCTTCAAACTGCATCAGTCAGAATCAAAAGCTTCTGGCCCATCAGG

Full Affymetrix probeset data:

Annotations for 1632946_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime