FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632949_at:

>probe:Drosophila_2:1632949_at:234:445; Interrogation_Position=1023; Antisense; GATGAGCCCATTGACTACGATCAGA
>probe:Drosophila_2:1632949_at:145:657; Interrogation_Position=1067; Antisense; TAATGTTATTTTCGTACGCGGACCG
>probe:Drosophila_2:1632949_at:548:669; Interrogation_Position=1081; Antisense; TACGCGGACCGAACCTATCGAAGGT
>probe:Drosophila_2:1632949_at:419:429; Interrogation_Position=1134; Antisense; GAGTTCGAGTTCGTGACATCGCCGA
>probe:Drosophila_2:1632949_at:473:269; Interrogation_Position=1193; Antisense; CATGCAGGCGGTGTTCAGCGTCGAA
>probe:Drosophila_2:1632949_at:669:179; Interrogation_Position=1257; Antisense; AAACAGACGGTGGTGGCTCGCTACA
>probe:Drosophila_2:1632949_at:444:665; Interrogation_Position=1278; Antisense; TACAAGAGCCAGCAGATCCGCATGA
>probe:Drosophila_2:1632949_at:578:449; Interrogation_Position=1292; Antisense; GATCCGCATGACCAACAAGGCGATG
>probe:Drosophila_2:1632949_at:255:579; Interrogation_Position=1356; Antisense; GGCCTCCTAGAACTGCATCTGGTAA
>probe:Drosophila_2:1632949_at:728:549; Interrogation_Position=1400; Antisense; GGAGATATTCATTCAGTTCTTCATA
>probe:Drosophila_2:1632949_at:628:275; Interrogation_Position=1418; Antisense; CTTCATAATTCCTTTGCTCAACACT
>probe:Drosophila_2:1632949_at:611:81; Interrogation_Position=940; Antisense; AGGGCGATCCCCTGAAGATAATTCT
>probe:Drosophila_2:1632949_at:454:455; Interrogation_Position=956; Antisense; GATAATTCTGTATCCGCACGACGAC
>probe:Drosophila_2:1632949_at:630:259; Interrogation_Position=992; Antisense; CACGGAGTGCGCCATCAAAACCATG

Paste this into a BLAST search page for me
GATGAGCCCATTGACTACGATCAGATAATGTTATTTTCGTACGCGGACCGTACGCGGACCGAACCTATCGAAGGTGAGTTCGAGTTCGTGACATCGCCGACATGCAGGCGGTGTTCAGCGTCGAAAAACAGACGGTGGTGGCTCGCTACATACAAGAGCCAGCAGATCCGCATGAGATCCGCATGACCAACAAGGCGATGGGCCTCCTAGAACTGCATCTGGTAAGGAGATATTCATTCAGTTCTTCATACTTCATAATTCCTTTGCTCAACACTAGGGCGATCCCCTGAAGATAATTCTGATAATTCTGTATCCGCACGACGACCACGGAGTGCGCCATCAAAACCATG

Full Affymetrix probeset data:

Annotations for 1632949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720