Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632950_at:

>probe:Drosophila_2:1632950_at:21:503; Interrogation_Position=1061; Antisense; GTCCGTGGCAGCTTTTTAAGCCTAA
>probe:Drosophila_2:1632950_at:714:677; Interrogation_Position=1076; Antisense; TTAAGCCTAAACAACGTCGACTCGT
>probe:Drosophila_2:1632950_at:466:403; Interrogation_Position=1094; Antisense; GACTCGTTCAGCTTTTGATTCTCAG
>probe:Drosophila_2:1632950_at:133:461; Interrogation_Position=1182; Antisense; GATTCTTCAAACTTCGGGTTCCATA
>probe:Drosophila_2:1632950_at:324:653; Interrogation_Position=1205; Antisense; TAATTGCGCTGGTTAAGTCCTTTCA
>probe:Drosophila_2:1632950_at:545:699; Interrogation_Position=654; Antisense; TTTTTATTTCGAGTTCTGTGCCCAC
>probe:Drosophila_2:1632950_at:251:35; Interrogation_Position=681; Antisense; ATCAGCTCTTTTCGAAGTGCTCCAG
>probe:Drosophila_2:1632950_at:290:705; Interrogation_Position=725; Antisense; TTAGACCCTACACTGATCACTTGGA
>probe:Drosophila_2:1632950_at:63:503; Interrogation_Position=753; Antisense; GTCGCCAGTGCAGCTTTACATTTTA
>probe:Drosophila_2:1632950_at:699:413; Interrogation_Position=828; Antisense; GACCAGATTTTTTCGTGATCGCTAT
>probe:Drosophila_2:1632950_at:526:603; Interrogation_Position=843; Antisense; TGATCGCTATACCATTATTACCCTG
>probe:Drosophila_2:1632950_at:392:541; Interrogation_Position=909; Antisense; GGTTAATCTCCTGACATTGGGCAAT
>probe:Drosophila_2:1632950_at:274:233; Interrogation_Position=948; Antisense; AATGCTCTATGTGGCCTACACGGTT
>probe:Drosophila_2:1632950_at:364:415; Interrogation_Position=981; Antisense; GAGCCAACTGCTGGTTTATTGCTAT

Paste this into a BLAST search page for me
GTCCGTGGCAGCTTTTTAAGCCTAATTAAGCCTAAACAACGTCGACTCGTGACTCGTTCAGCTTTTGATTCTCAGGATTCTTCAAACTTCGGGTTCCATATAATTGCGCTGGTTAAGTCCTTTCATTTTTATTTCGAGTTCTGTGCCCACATCAGCTCTTTTCGAAGTGCTCCAGTTAGACCCTACACTGATCACTTGGAGTCGCCAGTGCAGCTTTACATTTTAGACCAGATTTTTTCGTGATCGCTATTGATCGCTATACCATTATTACCCTGGGTTAATCTCCTGACATTGGGCAATAATGCTCTATGTGGCCTACACGGTTGAGCCAACTGCTGGTTTATTGCTAT

Full Affymetrix probeset data:

Annotations for 1632950_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime