FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632952_at:

>probe:Drosophila_2:1632952_at:601:317; Interrogation_Position=479; Antisense; GCCGGTGGATGCTTGCTAGCCACAT
>probe:Drosophila_2:1632952_at:657:661; Interrogation_Position=495; Antisense; TAGCCACATCCTGCGAGTATCGGGT
>probe:Drosophila_2:1632952_at:123:431; Interrogation_Position=509; Antisense; GAGTATCGGGTCATGGTGCCAAACT
>probe:Drosophila_2:1632952_at:376:255; Interrogation_Position=528; Antisense; CAAACTTTACCATCGGCCTGAACGA
>probe:Drosophila_2:1632952_at:137:187; Interrogation_Position=553; Antisense; AACACAGCTGGGTATTGTGGCGCCC
>probe:Drosophila_2:1632952_at:545:519; Interrogation_Position=580; Antisense; GTGGTTTATGGCCTCTTTCCTGAGC
>probe:Drosophila_2:1632952_at:371:291; Interrogation_Position=604; Antisense; CGTCTTGCCACAGCGAATTGCGGAA
>probe:Drosophila_2:1632952_at:540:81; Interrogation_Position=642; Antisense; AGGGTCGCATGTTCACCACGGAGGA
>probe:Drosophila_2:1632952_at:473:523; Interrogation_Position=679; Antisense; GGGCCTCATCGATGAGACTGCCAAT
>probe:Drosophila_2:1632952_at:155:171; Interrogation_Position=724; Antisense; AAAGTGTGTCGCCTTCATTGGCACC
>probe:Drosophila_2:1632952_at:679:219; Interrogation_Position=755; Antisense; AAGGTCAATCCGCTAGCCAGGTCAC
>probe:Drosophila_2:1632952_at:324:363; Interrogation_Position=790; Antisense; GCAATTCCGAGCTGCTGATCTACAG
>probe:Drosophila_2:1632952_at:291:395; Interrogation_Position=847; Antisense; GAAATTCCTGTTCTTTGTCAACCAG
>probe:Drosophila_2:1632952_at:420:221; Interrogation_Position=884; Antisense; AAGGGTCTGGGCATTTATCTCGAGG

Paste this into a BLAST search page for me
GCCGGTGGATGCTTGCTAGCCACATTAGCCACATCCTGCGAGTATCGGGTGAGTATCGGGTCATGGTGCCAAACTCAAACTTTACCATCGGCCTGAACGAAACACAGCTGGGTATTGTGGCGCCCGTGGTTTATGGCCTCTTTCCTGAGCCGTCTTGCCACAGCGAATTGCGGAAAGGGTCGCATGTTCACCACGGAGGAGGGCCTCATCGATGAGACTGCCAATAAAGTGTGTCGCCTTCATTGGCACCAAGGTCAATCCGCTAGCCAGGTCACGCAATTCCGAGCTGCTGATCTACAGGAAATTCCTGTTCTTTGTCAACCAGAAGGGTCTGGGCATTTATCTCGAGG

Full Affymetrix probeset data:

Annotations for 1632952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720