FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632953_at:

>probe:Drosophila_2:1632953_at:565:557; Interrogation_Position=120; Antisense; GGACATCAACTGCTCGGTCATTGAC
>probe:Drosophila_2:1632953_at:22:363; Interrogation_Position=200; Antisense; GCAATTTTTTGAACACCTTCCTCCT
>probe:Drosophila_2:1632953_at:21:623; Interrogation_Position=227; Antisense; TGCGCCGATCCGTCACGAAAATGTG
>probe:Drosophila_2:1632953_at:219:327; Interrogation_Position=263; Antisense; GCGTGGGACAGATCGCCAACCGAAA
>probe:Drosophila_2:1632953_at:563:169; Interrogation_Position=285; Antisense; AAAGGATCGTCCTGTTCAGCAACTC
>probe:Drosophila_2:1632953_at:174:583; Interrogation_Position=327; Antisense; TGGCTGCCACCTGATTGAGTTTCGC
>probe:Drosophila_2:1632953_at:50:175; Interrogation_Position=356; Antisense; AAAGCCGAATCCTGAATGCCGTGCT
>probe:Drosophila_2:1632953_at:283:619; Interrogation_Position=377; Antisense; TGCTCCACAAACTCTTGCAATCGGG
>probe:Drosophila_2:1632953_at:437:525; Interrogation_Position=399; Antisense; GGGAAACTATCCAGATGCCTGTCCT
>probe:Drosophila_2:1632953_at:45:371; Interrogation_Position=432; Antisense; GAATGTCAACTATACGTCCACGCGA
>probe:Drosophila_2:1632953_at:332:327; Interrogation_Position=453; Antisense; GCGATTTGCACTCAATCCGGATCAT
>probe:Drosophila_2:1632953_at:714:687; Interrogation_Position=47; Antisense; TATTATGCTGTCTGGTTGTGCCGAT
>probe:Drosophila_2:1632953_at:177:249; Interrogation_Position=515; Antisense; AATTGGTCTTTCAGCTGAGCAGGAA
>probe:Drosophila_2:1632953_at:341:565; Interrogation_Position=90; Antisense; GGCAACCCGCGATTTCGATATACGT

Paste this into a BLAST search page for me
GGACATCAACTGCTCGGTCATTGACGCAATTTTTTGAACACCTTCCTCCTTGCGCCGATCCGTCACGAAAATGTGGCGTGGGACAGATCGCCAACCGAAAAAAGGATCGTCCTGTTCAGCAACTCTGGCTGCCACCTGATTGAGTTTCGCAAAGCCGAATCCTGAATGCCGTGCTTGCTCCACAAACTCTTGCAATCGGGGGGAAACTATCCAGATGCCTGTCCTGAATGTCAACTATACGTCCACGCGAGCGATTTGCACTCAATCCGGATCATTATTATGCTGTCTGGTTGTGCCGATAATTGGTCTTTCAGCTGAGCAGGAAGGCAACCCGCGATTTCGATATACGT

Full Affymetrix probeset data:

Annotations for 1632953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720