Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632954_at:

>probe:Drosophila_2:1632954_at:418:475; Interrogation_Position=243; Antisense; GTTACGCGGCAGATGGTCCTCGTCG
>probe:Drosophila_2:1632954_at:484:319; Interrogation_Position=267; Antisense; GCCGAGAGCCGCAATTCGTGATCGA
>probe:Drosophila_2:1632954_at:505:159; Interrogation_Position=294; Antisense; ACAACTCGACCTGCTGGCGGAATGA
>probe:Drosophila_2:1632954_at:597:133; Interrogation_Position=345; Antisense; ACCCGTGCTCCGAATTCGATATAGT
>probe:Drosophila_2:1632954_at:293:7; Interrogation_Position=358; Antisense; ATTCGATATAGTCAGCCGGAGCTTG
>probe:Drosophila_2:1632954_at:697:551; Interrogation_Position=375; Antisense; GGAGCTTGGGCGTCTGCATTCACAC
>probe:Drosophila_2:1632954_at:251:345; Interrogation_Position=390; Antisense; GCATTCACACGCACTACAAGGAGGT
>probe:Drosophila_2:1632954_at:242:451; Interrogation_Position=436; Antisense; GATCGTAACCAGGAGCTGCGACCGG
>probe:Drosophila_2:1632954_at:640:19; Interrogation_Position=493; Antisense; ATTTGAGGTCTCGTGCTTTGTAATC
>probe:Drosophila_2:1632954_at:659:39; Interrogation_Position=515; Antisense; ATCGGATTACTTAGCTACCTGGTCA
>probe:Drosophila_2:1632954_at:236:673; Interrogation_Position=530; Antisense; TACCTGGTCAGTTATGCCCGCGATC
>probe:Drosophila_2:1632954_at:387:505; Interrogation_Position=562; Antisense; GTCCAGGCGCAACTACATGAGAATC
>probe:Drosophila_2:1632954_at:15:417; Interrogation_Position=587; Antisense; GAGCGACAGCTAAACCGGGTCCAAT
>probe:Drosophila_2:1632954_at:668:83; Interrogation_Position=645; Antisense; AGTGATACTCATTGACCGTACGGAA

Paste this into a BLAST search page for me
GTTACGCGGCAGATGGTCCTCGTCGGCCGAGAGCCGCAATTCGTGATCGAACAACTCGACCTGCTGGCGGAATGAACCCGTGCTCCGAATTCGATATAGTATTCGATATAGTCAGCCGGAGCTTGGGAGCTTGGGCGTCTGCATTCACACGCATTCACACGCACTACAAGGAGGTGATCGTAACCAGGAGCTGCGACCGGATTTGAGGTCTCGTGCTTTGTAATCATCGGATTACTTAGCTACCTGGTCATACCTGGTCAGTTATGCCCGCGATCGTCCAGGCGCAACTACATGAGAATCGAGCGACAGCTAAACCGGGTCCAATAGTGATACTCATTGACCGTACGGAA

Full Affymetrix probeset data:

Annotations for 1632954_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime