FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632955_at:

>probe:Drosophila_2:1632955_at:563:275; Interrogation_Position=1298; Antisense; CTTCAACCAAATGCTGTTCGAGCAA
>probe:Drosophila_2:1632955_at:290:233; Interrogation_Position=1307; Antisense; AATGCTGTTCGAGCAAAACATTGAT
>probe:Drosophila_2:1632955_at:173:471; Interrogation_Position=1313; Antisense; GTTCGAGCAAAACATTGATGGCCTC
>probe:Drosophila_2:1632955_at:222:191; Interrogation_Position=1323; Antisense; AACATTGATGGCCTCAAGCGCAGCC
>probe:Drosophila_2:1632955_at:302:7; Interrogation_Position=1326; Antisense; ATTGATGGCCTCAAGCGCAGCCTGT
>probe:Drosophila_2:1632955_at:658:649; Interrogation_Position=1336; Antisense; TCAAGCGCAGCCTGTCGACCAAGTC
>probe:Drosophila_2:1632955_at:482:597; Interrogation_Position=1348; Antisense; TGTCGACCAAGTCCCGACGAATGAG
>probe:Drosophila_2:1632955_at:264:219; Interrogation_Position=1356; Antisense; AAGTCCCGACGAATGAGTCGCATCA
>probe:Drosophila_2:1632955_at:366:57; Interrogation_Position=1368; Antisense; ATGAGTCGCATCACTGAGATCGCAC
>probe:Drosophila_2:1632955_at:610:431; Interrogation_Position=1370; Antisense; GAGTCGCATCACTGAGATCGCACTG
>probe:Drosophila_2:1632955_at:296:503; Interrogation_Position=1372; Antisense; GTCGCATCACTGAGATCGCACTGCT
>probe:Drosophila_2:1632955_at:303:345; Interrogation_Position=1375; Antisense; GCATCACTGAGATCGCACTGCTGCG
>probe:Drosophila_2:1632955_at:209:609; Interrogation_Position=1382; Antisense; TGAGATCGCACTGCTGCGCAAACAA
>probe:Drosophila_2:1632955_at:112:97; Interrogation_Position=1384; Antisense; AGATCGCACTGCTGCGCAAACAAAG

Paste this into a BLAST search page for me
CTTCAACCAAATGCTGTTCGAGCAAAATGCTGTTCGAGCAAAACATTGATGTTCGAGCAAAACATTGATGGCCTCAACATTGATGGCCTCAAGCGCAGCCATTGATGGCCTCAAGCGCAGCCTGTTCAAGCGCAGCCTGTCGACCAAGTCTGTCGACCAAGTCCCGACGAATGAGAAGTCCCGACGAATGAGTCGCATCAATGAGTCGCATCACTGAGATCGCACGAGTCGCATCACTGAGATCGCACTGGTCGCATCACTGAGATCGCACTGCTGCATCACTGAGATCGCACTGCTGCGTGAGATCGCACTGCTGCGCAAACAAAGATCGCACTGCTGCGCAAACAAAG

Full Affymetrix probeset data:

Annotations for 1632955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720