FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632956_at:

>probe:Drosophila_2:1632956_at:139:593; Interrogation_Position=1013; Antisense; TGGTGGACTGTCAGCTGAGCATCTC
>probe:Drosophila_2:1632956_at:274:281; Interrogation_Position=1037; Antisense; CTCCCAGTAACACTTTTCTTGTCGA
>probe:Drosophila_2:1632956_at:322:595; Interrogation_Position=1056; Antisense; TGTCGAGTTGGACGCTCCTTTAAGA
>probe:Drosophila_2:1632956_at:44:481; Interrogation_Position=1105; Antisense; GTATTCTATGACGACACAGCTTGTT
>probe:Drosophila_2:1632956_at:719:155; Interrogation_Position=1118; Antisense; ACACAGCTTGTTTGGGTTCGGCCCG
>probe:Drosophila_2:1632956_at:294:279; Interrogation_Position=1147; Antisense; CTCAGCGCTAATCCCCTAAAGAAAA
>probe:Drosophila_2:1632956_at:667:199; Interrogation_Position=1174; Antisense; AACGCACAGACGCAGCAAGCTCAAG
>probe:Drosophila_2:1632956_at:481:205; Interrogation_Position=1190; Antisense; AAGCTCAAGCCGCAAATCTGGTTAG
>probe:Drosophila_2:1632956_at:696:279; Interrogation_Position=1215; Antisense; CTAATGATGTTTCCTCTGAGCCAGA
>probe:Drosophila_2:1632956_at:567:439; Interrogation_Position=844; Antisense; GAGGCCGCAAGCAATACCATCTATG
>probe:Drosophila_2:1632956_at:668:27; Interrogation_Position=857; Antisense; ATACCATCTATGTGGCATCTGGCCA
>probe:Drosophila_2:1632956_at:193:597; Interrogation_Position=935; Antisense; TGTGTTCCAAGTCCCAACAGATTCT
>probe:Drosophila_2:1632956_at:220:95; Interrogation_Position=953; Antisense; AGATTCTTTCGGACACTGGCAGCTT
>probe:Drosophila_2:1632956_at:503:607; Interrogation_Position=977; Antisense; TGAGGTGTCGCTTTCGATTCCAGCA

Paste this into a BLAST search page for me
TGGTGGACTGTCAGCTGAGCATCTCCTCCCAGTAACACTTTTCTTGTCGATGTCGAGTTGGACGCTCCTTTAAGAGTATTCTATGACGACACAGCTTGTTACACAGCTTGTTTGGGTTCGGCCCGCTCAGCGCTAATCCCCTAAAGAAAAAACGCACAGACGCAGCAAGCTCAAGAAGCTCAAGCCGCAAATCTGGTTAGCTAATGATGTTTCCTCTGAGCCAGAGAGGCCGCAAGCAATACCATCTATGATACCATCTATGTGGCATCTGGCCATGTGTTCCAAGTCCCAACAGATTCTAGATTCTTTCGGACACTGGCAGCTTTGAGGTGTCGCTTTCGATTCCAGCA

Full Affymetrix probeset data:

Annotations for 1632956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720