Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632959_at:

>probe:Drosophila_2:1632959_at:328:137; Interrogation_Position=1399; Antisense; ACGACTACTGTAATCCCTATGCTTC
>probe:Drosophila_2:1632959_at:232:623; Interrogation_Position=1426; Antisense; TGCCGTACTGCAGCATACCGGATTG
>probe:Drosophila_2:1632959_at:672:673; Interrogation_Position=1441; Antisense; TACCGGATTGCAGCGAATGCCAGCA
>probe:Drosophila_2:1632959_at:134:643; Interrogation_Position=1492; Antisense; TCTACGGAACCATGGGCGGCTTGGT
>probe:Drosophila_2:1632959_at:163:37; Interrogation_Position=1555; Antisense; ATCATTCCAGCGGTGGTGACTCGTC
>probe:Drosophila_2:1632959_at:318:335; Interrogation_Position=1580; Antisense; GCTCTACTCGGGAATTTACGCACGT
>probe:Drosophila_2:1632959_at:578:135; Interrogation_Position=1597; Antisense; ACGCACGTAAATTCGGACTGAGCAA
>probe:Drosophila_2:1632959_at:41:369; Interrogation_Position=1622; Antisense; GAAGGGTCTACTGCAGATCGACTAC
>probe:Drosophila_2:1632959_at:628:449; Interrogation_Position=1637; Antisense; GATCGACTACTCATGCAGTTGGAAC
>probe:Drosophila_2:1632959_at:358:557; Interrogation_Position=1667; Antisense; GGACAGGGTGATGCAGCGCCATTAC
>probe:Drosophila_2:1632959_at:636:617; Interrogation_Position=1678; Antisense; TGCAGCGCCATTACTGAGATCCATG
>probe:Drosophila_2:1632959_at:263:303; Interrogation_Position=1706; Antisense; CCGCATCCACGTGGATCTGGGATTT
>probe:Drosophila_2:1632959_at:457:1; Interrogation_Position=1741; Antisense; GTTAGGCTAACTACCAACACGTTTG
>probe:Drosophila_2:1632959_at:524:187; Interrogation_Position=1756; Antisense; AACACGTTTGCACCAATCGCGAACA

Paste this into a BLAST search page for me
ACGACTACTGTAATCCCTATGCTTCTGCCGTACTGCAGCATACCGGATTGTACCGGATTGCAGCGAATGCCAGCATCTACGGAACCATGGGCGGCTTGGTATCATTCCAGCGGTGGTGACTCGTCGCTCTACTCGGGAATTTACGCACGTACGCACGTAAATTCGGACTGAGCAAGAAGGGTCTACTGCAGATCGACTACGATCGACTACTCATGCAGTTGGAACGGACAGGGTGATGCAGCGCCATTACTGCAGCGCCATTACTGAGATCCATGCCGCATCCACGTGGATCTGGGATTTGTTAGGCTAACTACCAACACGTTTGAACACGTTTGCACCAATCGCGAACA

Full Affymetrix probeset data:

Annotations for 1632959_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime