FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632960_at:

>probe:Drosophila_2:1632960_at:172:175; Interrogation_Position=1077; Antisense; AAAGCCATCCCGGACTGCGAGGATA
>probe:Drosophila_2:1632960_at:27:305; Interrogation_Position=1116; Antisense; CCGTTTCTGAATGCGCTCGAGTGAA
>probe:Drosophila_2:1632960_at:20:215; Interrogation_Position=1146; Antisense; AAGAGGCGCCTCTTGTGCGATGTGC
>probe:Drosophila_2:1632960_at:439:517; Interrogation_Position=1186; Antisense; GTGTGCTTTTATGGCCTGTGACTCA
>probe:Drosophila_2:1632960_at:162:447; Interrogation_Position=1232; Antisense; GATGCTCAACACGATGCTCAAGTCT
>probe:Drosophila_2:1632960_at:394:219; Interrogation_Position=1251; Antisense; AAGTCTTGGCGATCTTGGCTGCTGA
>probe:Drosophila_2:1632960_at:220:583; Interrogation_Position=1266; Antisense; TGGCTGCTGATATCGACCACAACGA
>probe:Drosophila_2:1632960_at:652:661; Interrogation_Position=1309; Antisense; TAAACAACTGACTTTCTAGCGTGAA
>probe:Drosophila_2:1632960_at:559:127; Interrogation_Position=840; Antisense; ACCATCATGAACTGCAAGCCCTTGA
>probe:Drosophila_2:1632960_at:431:205; Interrogation_Position=855; Antisense; AAGCCCTTGATTTTGTGCACCTTTG
>probe:Drosophila_2:1632960_at:268:351; Interrogation_Position=882; Antisense; GCAGTTGCAATGTGCCTGGTGCATT
>probe:Drosophila_2:1632960_at:289:345; Interrogation_Position=915; Antisense; GCATTGCCCGCCATAAGTCATTATA
>probe:Drosophila_2:1632960_at:42:461; Interrogation_Position=949; Antisense; GATTTGACTCCATGGGTGGCATTGA
>probe:Drosophila_2:1632960_at:443:81; Interrogation_Position=982; Antisense; AGGTGTGCCTTAACAACTGCGTCCA

Paste this into a BLAST search page for me
AAAGCCATCCCGGACTGCGAGGATACCGTTTCTGAATGCGCTCGAGTGAAAAGAGGCGCCTCTTGTGCGATGTGCGTGTGCTTTTATGGCCTGTGACTCAGATGCTCAACACGATGCTCAAGTCTAAGTCTTGGCGATCTTGGCTGCTGATGGCTGCTGATATCGACCACAACGATAAACAACTGACTTTCTAGCGTGAAACCATCATGAACTGCAAGCCCTTGAAAGCCCTTGATTTTGTGCACCTTTGGCAGTTGCAATGTGCCTGGTGCATTGCATTGCCCGCCATAAGTCATTATAGATTTGACTCCATGGGTGGCATTGAAGGTGTGCCTTAACAACTGCGTCCA

Full Affymetrix probeset data:

Annotations for 1632960_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720