FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632961_at:

>probe:Drosophila_2:1632961_at:115:549; Interrogation_Position=2255; Antisense; GGAGACCAGCAAGAAGGCCTTCCTC
>probe:Drosophila_2:1632961_at:602:169; Interrogation_Position=2281; Antisense; AAAGGAGCAGCCCAGCCAAGGATTC
>probe:Drosophila_2:1632961_at:225:79; Interrogation_Position=2299; Antisense; AGGATTCAGCCACCTGCTATTTATA
>probe:Drosophila_2:1632961_at:695:687; Interrogation_Position=2320; Antisense; TATATTTATCCACGATCCCCATATC
>probe:Drosophila_2:1632961_at:462:633; Interrogation_Position=2335; Antisense; TCCCCATATCCTCCAATAAGCAATA
>probe:Drosophila_2:1632961_at:531:637; Interrogation_Position=2365; Antisense; TCGATGTCATACAGAGCCTTCGCAT
>probe:Drosophila_2:1632961_at:719:415; Interrogation_Position=2378; Antisense; GAGCCTTCGCATACGTATTCACTAA
>probe:Drosophila_2:1632961_at:68:161; Interrogation_Position=2433; Antisense; AAAGGATCCTAACCTACTCGTATCA
>probe:Drosophila_2:1632961_at:49:147; Interrogation_Position=2448; Antisense; ACTCGTATCACTTGAGATCGTCTTT
>probe:Drosophila_2:1632961_at:562:97; Interrogation_Position=2462; Antisense; AGATCGTCTTTGTTTTCCTCATATC
>probe:Drosophila_2:1632961_at:468:717; Interrogation_Position=2476; Antisense; TTCCTCATATCATCACACACTGTGT
>probe:Drosophila_2:1632961_at:138:259; Interrogation_Position=2493; Antisense; CACTGTGTTTCGCAAAGCCTCATAT
>probe:Drosophila_2:1632961_at:323:709; Interrogation_Position=2546; Antisense; TTCACGAACGAGTCTACAATGGATC
>probe:Drosophila_2:1632961_at:533:13; Interrogation_Position=2808; Antisense; ATTACCATTCTGTTTAATCCAGCAA

Paste this into a BLAST search page for me
GGAGACCAGCAAGAAGGCCTTCCTCAAAGGAGCAGCCCAGCCAAGGATTCAGGATTCAGCCACCTGCTATTTATATATATTTATCCACGATCCCCATATCTCCCCATATCCTCCAATAAGCAATATCGATGTCATACAGAGCCTTCGCATGAGCCTTCGCATACGTATTCACTAAAAAGGATCCTAACCTACTCGTATCAACTCGTATCACTTGAGATCGTCTTTAGATCGTCTTTGTTTTCCTCATATCTTCCTCATATCATCACACACTGTGTCACTGTGTTTCGCAAAGCCTCATATTTCACGAACGAGTCTACAATGGATCATTACCATTCTGTTTAATCCAGCAA

Full Affymetrix probeset data:

Annotations for 1632961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720