FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632962_at:

>probe:Drosophila_2:1632962_at:117:281; Interrogation_Position=147; Antisense; CTCAGGGCAGGCGTCGTTACGACAG
>probe:Drosophila_2:1632962_at:587:713; Interrogation_Position=17; Antisense; TTCTTTTTTCGCCTTCACGAAATCA
>probe:Drosophila_2:1632962_at:124:187; Interrogation_Position=174; Antisense; AACAGCAGGGTTTCGGAGGTCAGAC
>probe:Drosophila_2:1632962_at:311:103; Interrogation_Position=195; Antisense; AGACCAAGCCCATCTTCAGGAAGAA
>probe:Drosophila_2:1632962_at:435:283; Interrogation_Position=245; Antisense; CTGCGTATGGAGTGCACCGAGTGCA
>probe:Drosophila_2:1632962_at:553:509; Interrogation_Position=265; Antisense; GTGCAAATACCGCAAGCAGACTCCC
>probe:Drosophila_2:1632962_at:91:105; Interrogation_Position=282; Antisense; AGACTCCCCTGAAGCGTTGCAAGCA
>probe:Drosophila_2:1632962_at:313:113; Interrogation_Position=303; Antisense; AGCACTTCGAGCTGGGCGGTGACAA
>probe:Drosophila_2:1632962_at:436:99; Interrogation_Position=342; Antisense; AGATGATCCAGTTCTAGGCACCTTC
>probe:Drosophila_2:1632962_at:86:681; Interrogation_Position=356; Antisense; TAGGCACCTTCTTTACACCATTAAA
>probe:Drosophila_2:1632962_at:518:589; Interrogation_Position=403; Antisense; TGGTTTTATGTTGTTTTCGCGTCGC
>probe:Drosophila_2:1632962_at:261:299; Interrogation_Position=420; Antisense; CGCGTCGCTGCACGGCGGCAAATAA
>probe:Drosophila_2:1632962_at:477:509; Interrogation_Position=47; Antisense; GTGAACGTACCGAAACAACGCCGCA
>probe:Drosophila_2:1632962_at:646:359; Interrogation_Position=87; Antisense; GCAAGGTCCACAAGCTGCACAAGGT

Paste this into a BLAST search page for me
CTCAGGGCAGGCGTCGTTACGACAGTTCTTTTTTCGCCTTCACGAAATCAAACAGCAGGGTTTCGGAGGTCAGACAGACCAAGCCCATCTTCAGGAAGAACTGCGTATGGAGTGCACCGAGTGCAGTGCAAATACCGCAAGCAGACTCCCAGACTCCCCTGAAGCGTTGCAAGCAAGCACTTCGAGCTGGGCGGTGACAAAGATGATCCAGTTCTAGGCACCTTCTAGGCACCTTCTTTACACCATTAAATGGTTTTATGTTGTTTTCGCGTCGCCGCGTCGCTGCACGGCGGCAAATAAGTGAACGTACCGAAACAACGCCGCAGCAAGGTCCACAAGCTGCACAAGGT

Full Affymetrix probeset data:

Annotations for 1632962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720