FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632963_at:

>probe:Drosophila_2:1632963_at:616:165; Interrogation_Position=2469; Antisense; AAATGTAAAGCACACGCTCGCGCGG
>probe:Drosophila_2:1632963_at:15:179; Interrogation_Position=2587; Antisense; AAACAGCTCCCAGAGAACTACGTCT
>probe:Drosophila_2:1632963_at:722:233; Interrogation_Position=2625; Antisense; AATGCCCCATAATCTACACCCGGTA
>probe:Drosophila_2:1632963_at:571:489; Interrogation_Position=2647; Antisense; GTACTATAACTAACCAGCCCCATGT
>probe:Drosophila_2:1632963_at:262:73; Interrogation_Position=2662; Antisense; AGCCCCATGTAGAGAGCCGTAGCCT
>probe:Drosophila_2:1632963_at:15:487; Interrogation_Position=2680; Antisense; GTAGCCTAGCTATGTCCATTGTCCT
>probe:Drosophila_2:1632963_at:393:355; Interrogation_Position=2713; Antisense; GCACTCGACTGTTTCGATCTATCAT
>probe:Drosophila_2:1632963_at:722:451; Interrogation_Position=2728; Antisense; GATCTATCATCACACATTATCCTCG
>probe:Drosophila_2:1632963_at:602:15; Interrogation_Position=2743; Antisense; ATTATCCTCGTCTCAGTGCTAGAGT
>probe:Drosophila_2:1632963_at:569:97; Interrogation_Position=2763; Antisense; AGAGTTCCACATCCTTGAGTAGCAG
>probe:Drosophila_2:1632963_at:13:455; Interrogation_Position=2806; Antisense; GATCAAGGCTAGTGGATCGCCCAAA
>probe:Drosophila_2:1632963_at:29:347; Interrogation_Position=2843; Antisense; GCATCATATTATTACGTTCACTGTT
>probe:Drosophila_2:1632963_at:617:685; Interrogation_Position=2894; Antisense; TATATGGATATGCTGCACCGGCGAC
>probe:Drosophila_2:1632963_at:606:615; Interrogation_Position=2907; Antisense; TGCACCGGCGACTATTAAACTGTAA

Paste this into a BLAST search page for me
AAATGTAAAGCACACGCTCGCGCGGAAACAGCTCCCAGAGAACTACGTCTAATGCCCCATAATCTACACCCGGTAGTACTATAACTAACCAGCCCCATGTAGCCCCATGTAGAGAGCCGTAGCCTGTAGCCTAGCTATGTCCATTGTCCTGCACTCGACTGTTTCGATCTATCATGATCTATCATCACACATTATCCTCGATTATCCTCGTCTCAGTGCTAGAGTAGAGTTCCACATCCTTGAGTAGCAGGATCAAGGCTAGTGGATCGCCCAAAGCATCATATTATTACGTTCACTGTTTATATGGATATGCTGCACCGGCGACTGCACCGGCGACTATTAAACTGTAA

Full Affymetrix probeset data:

Annotations for 1632963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720