Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632964_at:

>probe:Drosophila_2:1632964_at:542:515; Interrogation_Position=1049; Antisense; GTGTCTTTCGACTGCTACCAATATT
>probe:Drosophila_2:1632964_at:292:243; Interrogation_Position=1068; Antisense; AATATTAACATCACCCTGCACATTC
>probe:Drosophila_2:1632964_at:695:661; Interrogation_Position=1108; Antisense; TAAACGCCACGTCGCTAGTCTAAAA
>probe:Drosophila_2:1632964_at:708:705; Interrogation_Position=1138; Antisense; TTACTATTCACAAAACACACCCACT
>probe:Drosophila_2:1632964_at:300:175; Interrogation_Position=1226; Antisense; AAAGCCTAAACTTCATTCCGAGAAT
>probe:Drosophila_2:1632964_at:504:81; Interrogation_Position=707; Antisense; AGGTGGTCGACTACACGGGCTGCAA
>probe:Drosophila_2:1632964_at:396:157; Interrogation_Position=719; Antisense; ACACGGGCTGCAATGGACTGCTCAA
>probe:Drosophila_2:1632964_at:542:141; Interrogation_Position=735; Antisense; ACTGCTCAAGGTGGTCAAGTCCCTG
>probe:Drosophila_2:1632964_at:213:219; Interrogation_Position=751; Antisense; AAGTCCCTGGATCTTAGCGGCGATG
>probe:Drosophila_2:1632964_at:571:169; Interrogation_Position=782; Antisense; AAAGGCCCAGCTCTCGATCGAAAAA
>probe:Drosophila_2:1632964_at:479:251; Interrogation_Position=840; Antisense; CAAGTCCGGCGGCATTGAGATCGAC
>probe:Drosophila_2:1632964_at:439:141; Interrogation_Position=884; Antisense; ACGGAGCCGGGAACATTGTGATCAA
>probe:Drosophila_2:1632964_at:120:119; Interrogation_Position=942; Antisense; AGCTCTCTAAGTCATCTTTGGCCAA
>probe:Drosophila_2:1632964_at:540:57; Interrogation_Position=980; Antisense; ATGTAACGAAACTCTTGCCACCGAA

Paste this into a BLAST search page for me
GTGTCTTTCGACTGCTACCAATATTAATATTAACATCACCCTGCACATTCTAAACGCCACGTCGCTAGTCTAAAATTACTATTCACAAAACACACCCACTAAAGCCTAAACTTCATTCCGAGAATAGGTGGTCGACTACACGGGCTGCAAACACGGGCTGCAATGGACTGCTCAAACTGCTCAAGGTGGTCAAGTCCCTGAAGTCCCTGGATCTTAGCGGCGATGAAAGGCCCAGCTCTCGATCGAAAAACAAGTCCGGCGGCATTGAGATCGACACGGAGCCGGGAACATTGTGATCAAAGCTCTCTAAGTCATCTTTGGCCAAATGTAACGAAACTCTTGCCACCGAA

Full Affymetrix probeset data:

Annotations for 1632964_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime