FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632965_at:

>probe:Drosophila_2:1632965_at:529:233; Interrogation_Position=2806; Antisense; AATCGTCCGGTTGTCCAGTATGTAA
>probe:Drosophila_2:1632965_at:351:487; Interrogation_Position=2827; Antisense; GTAAAAGCCAGTGATCGGGATCCTT
>probe:Drosophila_2:1632965_at:47:43; Interrogation_Position=2840; Antisense; ATCGGGATCCTTTTTGCCTGAGAAA
>probe:Drosophila_2:1632965_at:165:127; Interrogation_Position=2891; Antisense; AGCCACCGAGATCCTTGTCAATGGA
>probe:Drosophila_2:1632965_at:214:405; Interrogation_Position=2914; Antisense; GACTCTCGTTTGGACAGTGTGGCTC
>probe:Drosophila_2:1632965_at:331:331; Interrogation_Position=2935; Antisense; GCTCTCCCCGAAGATCGGCTAATAA
>probe:Drosophila_2:1632965_at:421:75; Interrogation_Position=2970; Antisense; AGGACCTCCATCTGCAGCGGGTGAA
>probe:Drosophila_2:1632965_at:420:213; Interrogation_Position=2999; Antisense; AAGAGGAGGGCTTCCTTCTCAAAGC
>probe:Drosophila_2:1632965_at:727:713; Interrogation_Position=3014; Antisense; TTCTCAAAGCCCGTAATGTCTGCAC
>probe:Drosophila_2:1632965_at:44:499; Interrogation_Position=3031; Antisense; GTCTGCACCGAAATTTTACCCATTA
>probe:Drosophila_2:1632965_at:505:397; Interrogation_Position=3064; Antisense; GACAAGGGACGAATTTTCCTCAATT
>probe:Drosophila_2:1632965_at:663:651; Interrogation_Position=3083; Antisense; TCAATTTTCGCGAGGCAAGTGCCAT
>probe:Drosophila_2:1632965_at:395:245; Interrogation_Position=3154; Antisense; AATTTTGGCAGGATCCTTCCCAGGA
>probe:Drosophila_2:1632965_at:693:51; Interrogation_Position=3203; Antisense; ATGCTCTACCCTTTAGTGCGGTCAC

Paste this into a BLAST search page for me
AATCGTCCGGTTGTCCAGTATGTAAGTAAAAGCCAGTGATCGGGATCCTTATCGGGATCCTTTTTGCCTGAGAAAAGCCACCGAGATCCTTGTCAATGGAGACTCTCGTTTGGACAGTGTGGCTCGCTCTCCCCGAAGATCGGCTAATAAAGGACCTCCATCTGCAGCGGGTGAAAAGAGGAGGGCTTCCTTCTCAAAGCTTCTCAAAGCCCGTAATGTCTGCACGTCTGCACCGAAATTTTACCCATTAGACAAGGGACGAATTTTCCTCAATTTCAATTTTCGCGAGGCAAGTGCCATAATTTTGGCAGGATCCTTCCCAGGAATGCTCTACCCTTTAGTGCGGTCAC

Full Affymetrix probeset data:

Annotations for 1632965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720