Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632966_at:

>probe:Drosophila_2:1632966_at:486:99; Interrogation_Position=5399; Antisense; AGAGTTTTAAGAGTCGCGGCTAGAA
>probe:Drosophila_2:1632966_at:122:559; Interrogation_Position=5429; Antisense; GGAAAGTTGGCTCATCCTTTGCGAC
>probe:Drosophila_2:1632966_at:463:281; Interrogation_Position=5485; Antisense; CTCCATGCTACCATCATTTCATTAG
>probe:Drosophila_2:1632966_at:147:343; Interrogation_Position=5531; Antisense; GCATTTCAAACGACATTCGCCGGGT
>probe:Drosophila_2:1632966_at:154:403; Interrogation_Position=5542; Antisense; GACATTCGCCGGGTATTTCCACATT
>probe:Drosophila_2:1632966_at:91:483; Interrogation_Position=5554; Antisense; GTATTTCCACATTCCGAGTTAGCGA
>probe:Drosophila_2:1632966_at:603:325; Interrogation_Position=5575; Antisense; GCGACATTTCGCTTGAGGATGACTG
>probe:Drosophila_2:1632966_at:301:435; Interrogation_Position=5589; Antisense; GAGGATGACTGCAGATTTCGTTTTT
>probe:Drosophila_2:1632966_at:291:701; Interrogation_Position=5612; Antisense; TTTTGAGTACGCGTGCCTAACACTT
>probe:Drosophila_2:1632966_at:495:505; Interrogation_Position=5624; Antisense; GTGCCTAACACTTGTAGAGTCTGAA
>probe:Drosophila_2:1632966_at:334:607; Interrogation_Position=5649; Antisense; TGAGAATTACGCTGATTGCAAAACG
>probe:Drosophila_2:1632966_at:499:401; Interrogation_Position=5683; Antisense; GACATATTTATTCTAGTTCTAAGCC
>probe:Drosophila_2:1632966_at:597:471; Interrogation_Position=5698; Antisense; GTTCTAAGCCTATTTATTTGACTAT
>probe:Drosophila_2:1632966_at:92:123; Interrogation_Position=5752; Antisense; AGCGCGACGATTTGTGCGTTTGATT

Paste this into a BLAST search page for me
AGAGTTTTAAGAGTCGCGGCTAGAAGGAAAGTTGGCTCATCCTTTGCGACCTCCATGCTACCATCATTTCATTAGGCATTTCAAACGACATTCGCCGGGTGACATTCGCCGGGTATTTCCACATTGTATTTCCACATTCCGAGTTAGCGAGCGACATTTCGCTTGAGGATGACTGGAGGATGACTGCAGATTTCGTTTTTTTTTGAGTACGCGTGCCTAACACTTGTGCCTAACACTTGTAGAGTCTGAATGAGAATTACGCTGATTGCAAAACGGACATATTTATTCTAGTTCTAAGCCGTTCTAAGCCTATTTATTTGACTATAGCGCGACGATTTGTGCGTTTGATT

Full Affymetrix probeset data:

Annotations for 1632966_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime