FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632968_at:

>probe:Drosophila_2:1632968_at:260:1; Interrogation_Position=1179; Antisense; ATTTCCTAACTGTGGGCGACTGGTG
>probe:Drosophila_2:1632968_at:76:427; Interrogation_Position=1230; Antisense; GAGAGAGCTCCATCATCTGGACCAA
>probe:Drosophila_2:1632968_at:173:607; Interrogation_Position=1272; Antisense; TGACCGATGGCGCTTGGAGTTACAC
>probe:Drosophila_2:1632968_at:41:475; Interrogation_Position=1290; Antisense; GTTACACGAAAGTCTCCCAGTTCTT
>probe:Drosophila_2:1632968_at:396:309; Interrogation_Position=1306; Antisense; CCAGTTCTTTATCACTCGCATGGAT
>probe:Drosophila_2:1632968_at:208:441; Interrogation_Position=1328; Antisense; GATGGCGTCTTGGACACCTGGGATC
>probe:Drosophila_2:1632968_at:637:53; Interrogation_Position=1398; Antisense; ATGAACCTCTTTATTGTGTCCGGAC
>probe:Drosophila_2:1632968_at:656:591; Interrogation_Position=1461; Antisense; TGGGAGCCACTTTTCTCGTCGAAGT
>probe:Drosophila_2:1632968_at:566:373; Interrogation_Position=1481; Antisense; GAAGTCTCCGACAACATGGTCATGT
>probe:Drosophila_2:1632968_at:673:661; Interrogation_Position=1530; Antisense; TAACAGCCATGTTCGAGCGCGAGAA
>probe:Drosophila_2:1632968_at:608:285; Interrogation_Position=1571; Antisense; CTGGAGGCCAAGTCCCGGGAAAGCA
>probe:Drosophila_2:1632968_at:280:189; Interrogation_Position=1661; Antisense; AACATGGCTCCGTTTGAAGCAGCTT
>probe:Drosophila_2:1632968_at:526:421; Interrogation_Position=1688; Antisense; GAGCAAGCTGCCTCGGAATACTTTG
>probe:Drosophila_2:1632968_at:587:665; Interrogation_Position=1706; Antisense; TACTTTGCGGCCGTGGAACAGGAAC

Paste this into a BLAST search page for me
ATTTCCTAACTGTGGGCGACTGGTGGAGAGAGCTCCATCATCTGGACCAATGACCGATGGCGCTTGGAGTTACACGTTACACGAAAGTCTCCCAGTTCTTCCAGTTCTTTATCACTCGCATGGATGATGGCGTCTTGGACACCTGGGATCATGAACCTCTTTATTGTGTCCGGACTGGGAGCCACTTTTCTCGTCGAAGTGAAGTCTCCGACAACATGGTCATGTTAACAGCCATGTTCGAGCGCGAGAACTGGAGGCCAAGTCCCGGGAAAGCAAACATGGCTCCGTTTGAAGCAGCTTGAGCAAGCTGCCTCGGAATACTTTGTACTTTGCGGCCGTGGAACAGGAAC

Full Affymetrix probeset data:

Annotations for 1632968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720