Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632969_at:

>probe:Drosophila_2:1632969_at:260:299; Interrogation_Position=2967; Antisense; CGCGTTCTGTCGGTGTGCAACAAGG
>probe:Drosophila_2:1632969_at:697:107; Interrogation_Position=3002; Antisense; AGAACCATTTGATCGGGCTTTGTCC
>probe:Drosophila_2:1632969_at:409:77; Interrogation_Position=3039; Antisense; AGGATCGGTATCTCTACGGGTCAGA
>probe:Drosophila_2:1632969_at:459:681; Interrogation_Position=3125; Antisense; TATGGCCTCCCGAATGGAATCGACT
>probe:Drosophila_2:1632969_at:422:367; Interrogation_Position=3141; Antisense; GAATCGACTGGTTTGTCTGGACATA
>probe:Drosophila_2:1632969_at:145:425; Interrogation_Position=3180; Antisense; GAGACTGCCCAAACGCTCGAGGAGT
>probe:Drosophila_2:1632969_at:558:443; Interrogation_Position=3207; Antisense; GATGTTATGTGCTATTATCGCGGCT
>probe:Drosophila_2:1632969_at:310:13; Interrogation_Position=3220; Antisense; ATTATCGCGGCTTAACCTTTGTGAA
>probe:Drosophila_2:1632969_at:514:403; Interrogation_Position=3319; Antisense; GACTTTCTGAGAACCCATCTAATCC
>probe:Drosophila_2:1632969_at:343:451; Interrogation_Position=3345; Antisense; GATCTAAACCATGACCTGGACGGCT
>probe:Drosophila_2:1632969_at:261:585; Interrogation_Position=3361; Antisense; TGGACGGCTCCTAAGACAGATACAA
>probe:Drosophila_2:1632969_at:363:717; Interrogation_Position=3391; Antisense; TTCGGCAAATTCTTCTCAATATGGA
>probe:Drosophila_2:1632969_at:501:369; Interrogation_Position=3438; Antisense; GAAGGCTTCGTTTCTCAAATTTTGA
>probe:Drosophila_2:1632969_at:91:423; Interrogation_Position=3461; Antisense; GAGATCGTAGTTCTTGTCTGTAAAA

Paste this into a BLAST search page for me
CGCGTTCTGTCGGTGTGCAACAAGGAGAACCATTTGATCGGGCTTTGTCCAGGATCGGTATCTCTACGGGTCAGATATGGCCTCCCGAATGGAATCGACTGAATCGACTGGTTTGTCTGGACATAGAGACTGCCCAAACGCTCGAGGAGTGATGTTATGTGCTATTATCGCGGCTATTATCGCGGCTTAACCTTTGTGAAGACTTTCTGAGAACCCATCTAATCCGATCTAAACCATGACCTGGACGGCTTGGACGGCTCCTAAGACAGATACAATTCGGCAAATTCTTCTCAATATGGAGAAGGCTTCGTTTCTCAAATTTTGAGAGATCGTAGTTCTTGTCTGTAAAA

Full Affymetrix probeset data:

Annotations for 1632969_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime