FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632970_at:

>probe:Drosophila_2:1632970_at:430:149; Interrogation_Position=120; Antisense; ACTTATGTGCGAGTTCTGCGGCTAT
>probe:Drosophila_2:1632970_at:455:277; Interrogation_Position=141; Antisense; CTATCGGACGCGCATCTATTGGAAT
>probe:Drosophila_2:1632970_at:484:367; Interrogation_Position=162; Antisense; GAATCTGCAGATCCATCGTCGGCGA
>probe:Drosophila_2:1632970_at:177:95; Interrogation_Position=208; Antisense; AGTTGCCAGCAATGCCAGGCGCGTT
>probe:Drosophila_2:1632970_at:416:175; Interrogation_Position=254; Antisense; AAAGCCACTTGGAGCGGCACTTGGA
>probe:Drosophila_2:1632970_at:510:527; Interrogation_Position=26; Antisense; GGGTGCGTCTAACAATAGTGCCGAC
>probe:Drosophila_2:1632970_at:547:15; Interrogation_Position=304; Antisense; ATTTGCACCGACTGCAACGTGGGTT
>probe:Drosophila_2:1632970_at:631:151; Interrogation_Position=318; Antisense; CAACGTGGGTTTCTCCAGTTCGCGG
>probe:Drosophila_2:1632970_at:551:127; Interrogation_Position=356; Antisense; ACCGGACGCTCCACGAGGATGGGAA
>probe:Drosophila_2:1632970_at:504:85; Interrogation_Position=389; Antisense; AGTGCTCCCAGTGCGACAAGTCGTT
>probe:Drosophila_2:1632970_at:94:463; Interrogation_Position=447; Antisense; GATTCACCGCCAGAGGAACCAGCGA
>probe:Drosophila_2:1632970_at:629:711; Interrogation_Position=519; Antisense; TTCAAGTGTTTTTCATCGGCGCGAG
>probe:Drosophila_2:1632970_at:620:13; Interrogation_Position=52; Antisense; ATTAGATTTGGCACACGCGGACCGA
>probe:Drosophila_2:1632970_at:357:641; Interrogation_Position=534; Antisense; TCGGCGCGAGTTTAACACTGCATAA

Paste this into a BLAST search page for me
ACTTATGTGCGAGTTCTGCGGCTATCTATCGGACGCGCATCTATTGGAATGAATCTGCAGATCCATCGTCGGCGAAGTTGCCAGCAATGCCAGGCGCGTTAAAGCCACTTGGAGCGGCACTTGGAGGGTGCGTCTAACAATAGTGCCGACATTTGCACCGACTGCAACGTGGGTTCAACGTGGGTTTCTCCAGTTCGCGGACCGGACGCTCCACGAGGATGGGAAAGTGCTCCCAGTGCGACAAGTCGTTGATTCACCGCCAGAGGAACCAGCGATTCAAGTGTTTTTCATCGGCGCGAGATTAGATTTGGCACACGCGGACCGATCGGCGCGAGTTTAACACTGCATAA

Full Affymetrix probeset data:

Annotations for 1632970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720