FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632971_at:

>probe:Drosophila_2:1632971_at:622:633; Interrogation_Position=100; Antisense; TCGCCTCGCCAGCAATTTGGACAAA
>probe:Drosophila_2:1632971_at:708:3; Interrogation_Position=149; Antisense; ATTGTGGACTACGATGATCCGCCGC
>probe:Drosophila_2:1632971_at:456:345; Interrogation_Position=172; Antisense; GCATTTGCCAGTTCCGGAATATCCT
>probe:Drosophila_2:1632971_at:271:445; Interrogation_Position=206; Antisense; GATGAGCCGCTGGAAACTCGCAAGC
>probe:Drosophila_2:1632971_at:278:537; Interrogation_Position=21; Antisense; GGTCGTTTCCTAAAATGTTGCGGCA
>probe:Drosophila_2:1632971_at:587:387; Interrogation_Position=269; Antisense; GAAAACGATCTCTTGCTGAGCACTT
>probe:Drosophila_2:1632971_at:520:609; Interrogation_Position=285; Antisense; TGAGCACTTTTGTGGCCAAGCATTT
>probe:Drosophila_2:1632971_at:701:371; Interrogation_Position=310; Antisense; GAAGGACTTCAATGCCGAGCAGACC
>probe:Drosophila_2:1632971_at:716:411; Interrogation_Position=331; Antisense; GACCGCCGAGTACGATCAGTTGATC
>probe:Drosophila_2:1632971_at:48:531; Interrogation_Position=375; Antisense; GGGATATATTCTACTGGGCCACCGA
>probe:Drosophila_2:1632971_at:372:657; Interrogation_Position=486; Antisense; TAAGGCAGCCGGATTTGTGAACATT
>probe:Drosophila_2:1632971_at:400:25; Interrogation_Position=50; Antisense; ATAGTATCTACGGTAGGCCGTCGCC
>probe:Drosophila_2:1632971_at:59:515; Interrogation_Position=560; Antisense; GTGTTATTCTACTCCTGATCCTTAA
>probe:Drosophila_2:1632971_at:596:283; Interrogation_Position=74; Antisense; CTGCAACTACCTATGATGGCCCAAA

Paste this into a BLAST search page for me
TCGCCTCGCCAGCAATTTGGACAAAATTGTGGACTACGATGATCCGCCGCGCATTTGCCAGTTCCGGAATATCCTGATGAGCCGCTGGAAACTCGCAAGCGGTCGTTTCCTAAAATGTTGCGGCAGAAAACGATCTCTTGCTGAGCACTTTGAGCACTTTTGTGGCCAAGCATTTGAAGGACTTCAATGCCGAGCAGACCGACCGCCGAGTACGATCAGTTGATCGGGATATATTCTACTGGGCCACCGATAAGGCAGCCGGATTTGTGAACATTATAGTATCTACGGTAGGCCGTCGCCGTGTTATTCTACTCCTGATCCTTAACTGCAACTACCTATGATGGCCCAAA

Full Affymetrix probeset data:

Annotations for 1632971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720