FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632973_at:

>probe:Drosophila_2:1632973_at:252:439; Interrogation_Position=1366; Antisense; GAGGCTCAAGCCAAATTCGACTACC
>probe:Drosophila_2:1632973_at:428:11; Interrogation_Position=1380; Antisense; ATTCGACTACCAGATCAGCGTGGAT
>probe:Drosophila_2:1632973_at:453:503; Interrogation_Position=1440; Antisense; GTCCGCCGGAGTGGTCAACAGCAAC
>probe:Drosophila_2:1632973_at:730:711; Interrogation_Position=1471; Antisense; TTCTTCATCGTCAGCAAGTACGGCA
>probe:Drosophila_2:1632973_at:581:89; Interrogation_Position=1487; Antisense; AGTACGGCACCAAGCAGATCATGCT
>probe:Drosophila_2:1632973_at:49:187; Interrogation_Position=1517; Antisense; AACACACCTTCAATCGTCACATCTG
>probe:Drosophila_2:1632973_at:424:137; Interrogation_Position=1547; Antisense; ACGACGTCACCTATTGGCGCTGCAG
>probe:Drosophila_2:1632973_at:271:575; Interrogation_Position=1562; Antisense; GGCGCTGCAGCCAGTTCGCAGTGTT
>probe:Drosophila_2:1632973_at:355:639; Interrogation_Position=1593; Antisense; TCGTGCGCGGCTCAAGACCAAATTG
>probe:Drosophila_2:1632973_at:182:249; Interrogation_Position=1613; Antisense; AATTGGATACACTCACCATCCTGAA
>probe:Drosophila_2:1632973_at:630:155; Interrogation_Position=1637; Antisense; ACAGCGAGCACAACCATGAAGTTAT
>probe:Drosophila_2:1632973_at:168:55; Interrogation_Position=1652; Antisense; ATGAAGTTATCACTAAGGCGCGAAA
>probe:Drosophila_2:1632973_at:401:393; Interrogation_Position=1673; Antisense; GAAAGTACGGCTCCCTGAAGCGACA
>probe:Drosophila_2:1632973_at:51:411; Interrogation_Position=1729; Antisense; GAGCGTCGTCAGGACCCATTGGAAA

Paste this into a BLAST search page for me
GAGGCTCAAGCCAAATTCGACTACCATTCGACTACCAGATCAGCGTGGATGTCCGCCGGAGTGGTCAACAGCAACTTCTTCATCGTCAGCAAGTACGGCAAGTACGGCACCAAGCAGATCATGCTAACACACCTTCAATCGTCACATCTGACGACGTCACCTATTGGCGCTGCAGGGCGCTGCAGCCAGTTCGCAGTGTTTCGTGCGCGGCTCAAGACCAAATTGAATTGGATACACTCACCATCCTGAAACAGCGAGCACAACCATGAAGTTATATGAAGTTATCACTAAGGCGCGAAAGAAAGTACGGCTCCCTGAAGCGACAGAGCGTCGTCAGGACCCATTGGAAA

Full Affymetrix probeset data:

Annotations for 1632973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720