FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632975_at:

>probe:Drosophila_2:1632975_at:287:725; Interrogation_Position=274; Antisense; TTGAGAAGCTGATTCCCACGGTTAC
>probe:Drosophila_2:1632975_at:201:717; Interrogation_Position=335; Antisense; TTCCGGATTCCGTAAGGCCATTAAG
>probe:Drosophila_2:1632975_at:352:579; Interrogation_Position=350; Antisense; GGCCATTAAGTTTTTGCGCAGCTCC
>probe:Drosophila_2:1632975_at:593:631; Interrogation_Position=372; Antisense; TCCGATTTCAAGACGCTGCAGCAGC
>probe:Drosophila_2:1632975_at:336:121; Interrogation_Position=394; Antisense; AGCGCATTGAGTCTCTGCCAGAAGT
>probe:Drosophila_2:1632975_at:408:543; Interrogation_Position=422; Antisense; GGATCTAATTAATTTCGTGCACCTC
>probe:Drosophila_2:1632975_at:217:347; Interrogation_Position=440; Antisense; GCACCTCAATGATACGACCCAAGAA
>probe:Drosophila_2:1632975_at:268:23; Interrogation_Position=497; Antisense; ATATAACAGGCTTCGCAGGTCGGCT
>probe:Drosophila_2:1632975_at:679:1; Interrogation_Position=537; Antisense; ATTGTTTTGGTGCTACTCGAATCGA
>probe:Drosophila_2:1632975_at:144:91; Interrogation_Position=577; Antisense; AGTTGAGTTCGTTCACCAGTTTCGT
>probe:Drosophila_2:1632975_at:115:393; Interrogation_Position=606; Antisense; GAAATACTAACGCATTTGCCCCGTG
>probe:Drosophila_2:1632975_at:86:351; Interrogation_Position=662; Antisense; GCAGAAGAGTGCCTTGTTCGCCAAG
>probe:Drosophila_2:1632975_at:650:631; Interrogation_Position=679; Antisense; TCGCCAAGTTCTATCAGGCACTGAA
>probe:Drosophila_2:1632975_at:428:107; Interrogation_Position=770; Antisense; AGAACTTTCGCGACACGCAATCGAT

Paste this into a BLAST search page for me
TTGAGAAGCTGATTCCCACGGTTACTTCCGGATTCCGTAAGGCCATTAAGGGCCATTAAGTTTTTGCGCAGCTCCTCCGATTTCAAGACGCTGCAGCAGCAGCGCATTGAGTCTCTGCCAGAAGTGGATCTAATTAATTTCGTGCACCTCGCACCTCAATGATACGACCCAAGAAATATAACAGGCTTCGCAGGTCGGCTATTGTTTTGGTGCTACTCGAATCGAAGTTGAGTTCGTTCACCAGTTTCGTGAAATACTAACGCATTTGCCCCGTGGCAGAAGAGTGCCTTGTTCGCCAAGTCGCCAAGTTCTATCAGGCACTGAAAGAACTTTCGCGACACGCAATCGAT

Full Affymetrix probeset data:

Annotations for 1632975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720