Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632977_at:

>probe:Drosophila_2:1632977_at:395:263; Interrogation_Position=1603; Antisense; CAGAGGCTTCACCAGGATCGACACT
>probe:Drosophila_2:1632977_at:499:365; Interrogation_Position=1646; Antisense; GAATCCGTACTCCATCGAAGAACTG
>probe:Drosophila_2:1632977_at:478:391; Interrogation_Position=1685; Antisense; GAAACGACTCCGACTGGATAGCAAC
>probe:Drosophila_2:1632977_at:217:27; Interrogation_Position=1702; Antisense; ATAGCAACCGTCTGGAGTGCCTGGA
>probe:Drosophila_2:1632977_at:202:565; Interrogation_Position=1724; Antisense; GGAATCCAGTTCCTGCGAGAGCAGC
>probe:Drosophila_2:1632977_at:322:127; Interrogation_Position=1746; Antisense; AGCCAGGATAGTCCAGTTGCTCCAC
>probe:Drosophila_2:1632977_at:485:617; Interrogation_Position=1766; Antisense; TCCACCCTTGGAAACGCCAGAGGAT
>probe:Drosophila_2:1632977_at:15:665; Interrogation_Position=1851; Antisense; TAAATCCACTGAGTGCGTCTCGCCA
>probe:Drosophila_2:1632977_at:241:199; Interrogation_Position=1924; Antisense; AACGCCCCATTCAAACAGTACTAAT
>probe:Drosophila_2:1632977_at:178:607; Interrogation_Position=1972; Antisense; TGATGGAATTTCTGTGGTCACACGA
>probe:Drosophila_2:1632977_at:64:539; Interrogation_Position=1987; Antisense; GGTCACACGATCTTTTCACTTTCTT
>probe:Drosophila_2:1632977_at:216:645; Interrogation_Position=2002; Antisense; TCACTTTCTTCTCTCTTAAACTGGA
>probe:Drosophila_2:1632977_at:619:601; Interrogation_Position=2085; Antisense; TGTATTCATTCCAAGTTCCATCCAC
>probe:Drosophila_2:1632977_at:591:469; Interrogation_Position=2099; Antisense; GTTCCATCCACATTGATTGCTATGA

Paste this into a BLAST search page for me
CAGAGGCTTCACCAGGATCGACACTGAATCCGTACTCCATCGAAGAACTGGAAACGACTCCGACTGGATAGCAACATAGCAACCGTCTGGAGTGCCTGGAGGAATCCAGTTCCTGCGAGAGCAGCAGCCAGGATAGTCCAGTTGCTCCACTCCACCCTTGGAAACGCCAGAGGATTAAATCCACTGAGTGCGTCTCGCCAAACGCCCCATTCAAACAGTACTAATTGATGGAATTTCTGTGGTCACACGAGGTCACACGATCTTTTCACTTTCTTTCACTTTCTTCTCTCTTAAACTGGATGTATTCATTCCAAGTTCCATCCACGTTCCATCCACATTGATTGCTATGA

Full Affymetrix probeset data:

Annotations for 1632977_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime