FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632978_at:

>probe:Drosophila_2:1632978_at:189:675; Interrogation_Position=1070; Antisense; TAGGTCTTTCGCTAAATGATTACCG
>probe:Drosophila_2:1632978_at:485:203; Interrogation_Position=611; Antisense; AAGCCTGGACTGATTGGTGCGCCTT
>probe:Drosophila_2:1632978_at:182:557; Interrogation_Position=617; Antisense; GGACTGATTGGTGCGCCTTTGGCCT
>probe:Drosophila_2:1632978_at:726:689; Interrogation_Position=634; Antisense; TTTGGCCTACACTGCTTACGTGGCT
>probe:Drosophila_2:1632978_at:508:705; Interrogation_Position=658; Antisense; TTACTCTCCTCTGGCTGTACTAATG
>probe:Drosophila_2:1632978_at:674:581; Interrogation_Position=669; Antisense; TGGCTGTACTAATGGCCTACCCCTC
>probe:Drosophila_2:1632978_at:719:255; Interrogation_Position=771; Antisense; CACCTCGGAGGCGACGATAATAAAT
>probe:Drosophila_2:1632978_at:70:481; Interrogation_Position=823; Antisense; GTATATTCTTATTTAAGCACGCTTC
>probe:Drosophila_2:1632978_at:308:113; Interrogation_Position=838; Antisense; AGCACGCTTCAAATTAATATTCATT
>probe:Drosophila_2:1632978_at:504:161; Interrogation_Position=875; Antisense; AAATTAGCTCTGAACGTACACGAAA
>probe:Drosophila_2:1632978_at:654:385; Interrogation_Position=910; Antisense; GAAAATTTCCCAGCATTGATTAACA
>probe:Drosophila_2:1632978_at:671:243; Interrogation_Position=966; Antisense; AATTTTAACGACTGATGCATTTCTC
>probe:Drosophila_2:1632978_at:522:619; Interrogation_Position=981; Antisense; TGCATTTCTCAATCACAGCCATTTC
>probe:Drosophila_2:1632978_at:27:263; Interrogation_Position=996; Antisense; CAGCCATTTCTAAATCAATCGTCAA

Paste this into a BLAST search page for me
TAGGTCTTTCGCTAAATGATTACCGAAGCCTGGACTGATTGGTGCGCCTTGGACTGATTGGTGCGCCTTTGGCCTTTTGGCCTACACTGCTTACGTGGCTTTACTCTCCTCTGGCTGTACTAATGTGGCTGTACTAATGGCCTACCCCTCCACCTCGGAGGCGACGATAATAAATGTATATTCTTATTTAAGCACGCTTCAGCACGCTTCAAATTAATATTCATTAAATTAGCTCTGAACGTACACGAAAGAAAATTTCCCAGCATTGATTAACAAATTTTAACGACTGATGCATTTCTCTGCATTTCTCAATCACAGCCATTTCCAGCCATTTCTAAATCAATCGTCAA

Full Affymetrix probeset data:

Annotations for 1632978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720