Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632979_at:

>probe:Drosophila_2:1632979_at:670:215; Interrogation_Position=308; Antisense; AAGTACGCCGGGAATGACCAACTCT
>probe:Drosophila_2:1632979_at:3:415; Interrogation_Position=323; Antisense; GACCAACTCTATCCGCGGGATTTGA
>probe:Drosophila_2:1632979_at:207:185; Interrogation_Position=347; Antisense; AAAAGGAGAGCCCACATCGACCATC
>probe:Drosophila_2:1632979_at:201:637; Interrogation_Position=363; Antisense; TCGACCATCGCATGCACTACGAGAA
>probe:Drosophila_2:1632979_at:480:557; Interrogation_Position=412; Antisense; GGACATTGTGGCTCGGAACATTTAC
>probe:Drosophila_2:1632979_at:555:229; Interrogation_Position=482; Antisense; AATGCGTACTCCGACTTGGAACACT
>probe:Drosophila_2:1632979_at:551:379; Interrogation_Position=539; Antisense; GAACTGAGCGTTGCCGACGTGTCCA
>probe:Drosophila_2:1632979_at:723:639; Interrogation_Position=574; Antisense; TCTGGTGACCTTGGATCTGCTCATA
>probe:Drosophila_2:1632979_at:690:487; Interrogation_Position=616; Antisense; GTACCCGCAGACTAAGCAATGGATG
>probe:Drosophila_2:1632979_at:309:455; Interrogation_Position=676; Antisense; GATCAACCTCAAGGGTGCACGGGCT
>probe:Drosophila_2:1632979_at:153:415; Interrogation_Position=745; Antisense; GAGCCAGTAGATTCCTTCTTAATGA
>probe:Drosophila_2:1632979_at:295:439; Interrogation_Position=768; Antisense; GAGGCTCTCATGTTACACATTCACA
>probe:Drosophila_2:1632979_at:588:699; Interrogation_Position=800; Antisense; TTTTGTGTTCCCCATGTACGCAATT
>probe:Drosophila_2:1632979_at:703:103; Interrogation_Position=842; Antisense; AGACCGCTTGTCAATACTCCAATTT

Paste this into a BLAST search page for me
AAGTACGCCGGGAATGACCAACTCTGACCAACTCTATCCGCGGGATTTGAAAAAGGAGAGCCCACATCGACCATCTCGACCATCGCATGCACTACGAGAAGGACATTGTGGCTCGGAACATTTACAATGCGTACTCCGACTTGGAACACTGAACTGAGCGTTGCCGACGTGTCCATCTGGTGACCTTGGATCTGCTCATAGTACCCGCAGACTAAGCAATGGATGGATCAACCTCAAGGGTGCACGGGCTGAGCCAGTAGATTCCTTCTTAATGAGAGGCTCTCATGTTACACATTCACATTTTGTGTTCCCCATGTACGCAATTAGACCGCTTGTCAATACTCCAATTT

Full Affymetrix probeset data:

Annotations for 1632979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime