Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632980_at:

>probe:Drosophila_2:1632980_at:156:417; Interrogation_Position=1019; Antisense; GAGCGCAAGCAGTTCGGTGATGCCA
>probe:Drosophila_2:1632980_at:686:533; Interrogation_Position=1034; Antisense; GGTGATGCCATCTATAACTTCCAGT
>probe:Drosophila_2:1632980_at:539:31; Interrogation_Position=1047; Antisense; ATAACTTCCAGTCGATGCAGCATCA
>probe:Drosophila_2:1632980_at:403:445; Interrogation_Position=1111; Antisense; GATGACCTACAATGCTGCACGTCTG
>probe:Drosophila_2:1632980_at:608:517; Interrogation_Position=1235; Antisense; GGAGGCGTTGGCTTCACCCGTGATT
>probe:Drosophila_2:1632980_at:57:261; Interrogation_Position=1249; Antisense; CACCCGTGATTTCCCGCAGGAGAAG
>probe:Drosophila_2:1632980_at:637:291; Interrogation_Position=1280; Antisense; CGTGACGTGAAGATCGGAGCCATTT
>probe:Drosophila_2:1632980_at:168:415; Interrogation_Position=1296; Antisense; GAGCCATTTACGAGGGCACCACCAA
>probe:Drosophila_2:1632980_at:705:189; Interrogation_Position=1319; Antisense; AACATGCAGCTGAGCACCATTGCCA
>probe:Drosophila_2:1632980_at:622:459; Interrogation_Position=1358; Antisense; GATTATGCGGCCTAAAGACTACCCC
>probe:Drosophila_2:1632980_at:576:695; Interrogation_Position=1454; Antisense; TTATGCGTGGGAACCGCTGGAACAA
>probe:Drosophila_2:1632980_at:509:561; Interrogation_Position=1472; Antisense; GGAACAATTTTGACGGCCATCCGTT
>probe:Drosophila_2:1632980_at:173:41; Interrogation_Position=1497; Antisense; ATCGGTTCTCACCATGTTAACGTAG
>probe:Drosophila_2:1632980_at:428:291; Interrogation_Position=1517; Antisense; CGTAGCATTTACCACTTAGTTGATT

Paste this into a BLAST search page for me
GAGCGCAAGCAGTTCGGTGATGCCAGGTGATGCCATCTATAACTTCCAGTATAACTTCCAGTCGATGCAGCATCAGATGACCTACAATGCTGCACGTCTGGGAGGCGTTGGCTTCACCCGTGATTCACCCGTGATTTCCCGCAGGAGAAGCGTGACGTGAAGATCGGAGCCATTTGAGCCATTTACGAGGGCACCACCAAAACATGCAGCTGAGCACCATTGCCAGATTATGCGGCCTAAAGACTACCCCTTATGCGTGGGAACCGCTGGAACAAGGAACAATTTTGACGGCCATCCGTTATCGGTTCTCACCATGTTAACGTAGCGTAGCATTTACCACTTAGTTGATT

Full Affymetrix probeset data:

Annotations for 1632980_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime