FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632982_at:

>probe:Drosophila_2:1632982_at:511:253; Interrogation_Position=1021; Antisense; CAACGATCGCTTCGAGCTTAAGCTC
>probe:Drosophila_2:1632982_at:60:363; Interrogation_Position=1047; Antisense; GAATTAGTGGGTGTTCCATCTCCGA
>probe:Drosophila_2:1632982_at:513:35; Interrogation_Position=1064; Antisense; ATCTCCGACGGATATAGTCCTGTGT
>probe:Drosophila_2:1632982_at:559:209; Interrogation_Position=1133; Antisense; AAGACTTGGGACACCTTCTACATAG
>probe:Drosophila_2:1632982_at:39:273; Interrogation_Position=1153; Antisense; CATAGTCGAGTACGCTCAGTTGGCC
>probe:Drosophila_2:1632982_at:339:215; Interrogation_Position=1278; Antisense; AAGATGTGACTTTGGGCGGTGCCTT
>probe:Drosophila_2:1632982_at:15:331; Interrogation_Position=1293; Antisense; GCGGTGCCTTTACCATGCCAAATGG
>probe:Drosophila_2:1632982_at:665:607; Interrogation_Position=1369; Antisense; TGAGGAGCACTCCACTACGATTTGC
>probe:Drosophila_2:1632982_at:129:303; Interrogation_Position=1393; Antisense; CCCCATCATCGAGGGCACTGGATTA
>probe:Drosophila_2:1632982_at:486:507; Interrogation_Position=1423; Antisense; GTGCGATAGCATCATATCCCACTAT
>probe:Drosophila_2:1632982_at:351:31; Interrogation_Position=1446; Antisense; ATAAGTTCAAACTCCCTATCTCTCT
>probe:Drosophila_2:1632982_at:264:307; Interrogation_Position=1460; Antisense; CCTATCTCTCTTTTCAGTCATGATC
>probe:Drosophila_2:1632982_at:590:259; Interrogation_Position=1501; Antisense; CAGACGAGTAAGACCACCTGGTGTT
>probe:Drosophila_2:1632982_at:325:423; Interrogation_Position=995; Antisense; GAGAACGCATACGAGCGGTGTCCAC

Paste this into a BLAST search page for me
CAACGATCGCTTCGAGCTTAAGCTCGAATTAGTGGGTGTTCCATCTCCGAATCTCCGACGGATATAGTCCTGTGTAAGACTTGGGACACCTTCTACATAGCATAGTCGAGTACGCTCAGTTGGCCAAGATGTGACTTTGGGCGGTGCCTTGCGGTGCCTTTACCATGCCAAATGGTGAGGAGCACTCCACTACGATTTGCCCCCATCATCGAGGGCACTGGATTAGTGCGATAGCATCATATCCCACTATATAAGTTCAAACTCCCTATCTCTCTCCTATCTCTCTTTTCAGTCATGATCCAGACGAGTAAGACCACCTGGTGTTGAGAACGCATACGAGCGGTGTCCAC

Full Affymetrix probeset data:

Annotations for 1632982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720